RegulonDB RegulonDB 10.8: Gene Sequence
ribD gene sequence


Size: 1104        A: 256  T: 237  G: 322  C: 289

Fasta

 

>ribD E. coli K12. Version NC_000913.3 GI:556503834
gtgcaggacgagtattacatggcgcgggcgctaaagctggcgcaacgaggacgttttacc
acgcatcccaacccgaatgtcgggtgcgtcattgtcaaagatggcgaaattgtcggtgaa
ggttaccaccaacgtgcgggtgaaccacatgccgaagtacacgcgttgcgtatggcgggt
gaaaaagccaaaggtgcgaccgcctatgtcacactcgaaccctgtagccatcatggtcgt
acgccaccgtgctgtgacgcactcatcgccgctggcgtagcgcgcgtggttgcctcgatg
caagatcctaacccgcaggtcgctgggcgtggactttaccgtctgcaacaggctggcatt
gacgtcagccacggcctgatgatgagtgaagccgagcaattgaataaaggctttctcaag
cggatgcgcaccggctttccttatattcagttaaaacttggcgcatcgcttgatggtcgc
acggcgatggcgagcggcgaaagccagtggatcacttcgccccaggcgcggcgtgatgta
caactactgcgcgcgcaaagtcatgccattttaaccagcagcgccacggtgctggcggat
gatcctgccttaacggtgcgttggtctgaactggatgaacaaactcaggcgctctatccg
caacaaaatctccgtcagccgatacgtattgtgattgatagccaaaatcgcgtgacgccg
gtacatcgcattgtgcagcagcccggcgaaacctggttcgcgcgtacgcaggaagattct
cgtgagtggccggaaacggtgcgtaccttgctgattccagagcataaaggtcatctggat
ctggttgtactgatgatgcaactgggtaaacagcaaattaacagcatctgggtggaagcg
gggccaacgctcgctggcgcattgctgcaggcgggtttagtcgatgagctgattgtctat
atcgcacctaaactattaggcagcgacgcccgcggattatgcacgctgccagggcttgag
aaattagccgacgccccccaatttaaattcaaagagatacgtcatgtaggcccggatgtt
tgcctgcatttagtgggtgcatga
              
                            

Download fasta file
RegulonDB