RegulonDB RegulonDB 10.10: Gene Sequence
acnA gene sequence


Size: 2676        A: 655  T: 605  G: 749  C: 667

Fasta

 

>acnA E. coli K12. Version NC_000913.3 GI:556503834
atgtcgtcaaccctacgagaagccagtaaggacacgttgcaggccaaagataaaacttac
cactactacagcctgccgcttgctgctaaatcactgggcgatatcacccgtctacccaag
tcactcaaagttttgctcgaaaacctgctgcgctggcaggatggtaactcggttaccgaa
gaggatatccacgcgctggcaggatggctgaaaaatgcccatgctgaccgtgaaattgcc
taccgcccggcaagggtgctgatgcaggactttaccggcgtacctgccgttgttgatctg
gcggcaatgcgcgaagcggttaaacgcctcggcggcgatactgcaaaggttaacccgctc
tcaccggtcgacctggtcattgaccactcggtgaccgtcgatcgttttggtgatgatgag
gcatttgaagaaaacgtacgcctggaaatggagcgcaaccacgaacgttatgtgttcctg
aaatggggaaagcaagcgttcagtcggtttagcgtcgtgccgccaggcacaggcatttgc
catcaggttaacctcgaatatctcggcaaagcagtgtggagtgaattgcaggacggtgaa
tggattgcttatccggatacactcgttggtactgactcgcacaccaccatgatcaacggc
cttggcgtgctggggtggggcgttggtgggatcgaagcagaagccgcaatgttaggccag
ccggtttccatgcttatcccggatgtagtgggcttcaaacttaccggaaaattacgtgaa
ggtattaccgccacagacctggttctcactgttacccaaatgctgcgcaaacatggcgtg
gtggggaaattcgtcgaattttatggtgatggtctggattcactaccgttggcggatcgc
gccaccattgccaatatgtcgccagaatatggtgccacctgtggcttcttcccaatcgat
gctgtaaccctcgattacatgcgtttaagcgggcgcagcgaagatcaggtcgagttggtc
gaaaaatatgccaaagcgcagggcatgtggcgtaacccgggcgatgaaccaatttttacc
agtacgttagaactggatatgaatgacgttgaagcgagcctggcagggcctaaacgccca
caggatcgcgttgcactgcccgatgtaccaaaagcatttgccgccagtaacgaactggaa
gtgaatgccacgcataaagatcgccagccggtcgattatgttatgaacggacatcagtat
cagttacctgatggcgctgtggtcattgctgcgataacctcgtgcaccaacacctctaac
ccaagtgtgctgatggccgcaggcttgctggcgaaaaaagccgtaactctgggcctcaag
cggcaaccatgggtcaaagcgtcgctggcaccgggttcgaaagtcgtttctgattatctg
gcaaaagcgaaactgacaccgtatctcgacgaactggggtttaaccttgtgggatacggt
tgtaccacctgtattggtaactctgggccgctgcccgatcctatcgaaacggcaatcaaa
aaaagcgatttaaccgtcggtgcggtgctgtccggcaaccgtaactttgaaggccgtatc
catccgctggttaaaactaactggctggcctcgccgccgctggtggttgcctatgcgctg
gcgggaaatatgaatatcaacctggcttctgagcctatcggccatgatcgcaaaggcgat
ccggtttatctgaaagatatctggccatcggcacaagaaattgcccgtgcggtagaacaa
gtctccacagaaatgttccgcaaagagtacgcagaagtttttgaaggcacagcagagtgg
aagggaattaacgtcacacgatccgatacctacggttggcaggaggactcaacctatatt
cgcttatcgcctttctttgatgaaatgcaggcaacaccagcaccagtggaagatattcac
ggtgcgcggatcctcgcaatgctgggggattcagtcaccactgaccatatctctccggcg
ggcagtattaagcccgacagcccagcgggtcgatatctacaaggtcggggtgttgagcga
aaagactttaactcctacggttcgcggcgtggtaaccatgaagtgatgatgcgcggcacc
ttcgccaatattcgcatccgtaatgaaatggtgcctggcgttgaaggggggatgacgcgg
catttacctgacagcgacgtagtctctatttatgatgctgcgatgcgctataagcaggag
caaacgccgctggcggtgattgccgggaaagagtatggatcaggctccagtcgtgactgg
gcggcaaaaggtccgcgtctgcttggtattcgtgtggtgattgccgaatcgtttgaacga
attcaccgttcgaatttaattggcatgggcatcctgccgctggaatttccgcaaggcgta
acgcgtaaaacgttagggctaaccggggaagagaagattgatattggcgatctgcaaaac
ctacaacccggcgcgacggttccggtgacgcttacgcgcgcggatggtagccaggaagtc
gtaccctgccgttgtcgtatcgacaccgcgacggagttgacctactaccagaacgacggc
attttgcattatgtcattcgtaatatgttgaagtaa
              
                            

Download fasta file
RegulonDB