RegulonDB RegulonDB 10.8: Gene Sequence
codA gene sequence


Size: 1284        A: 318  T: 280  G: 354  C: 332

Fasta

 

>codA E. coli K12. Version NC_000913.3 GI:556503834
gtgtcgaataacgctttacaaacaattattaacgcccggttaccaggcgaagaggggctg
tggcagattcatctgcaggacggaaaaatcagcgccattgatgcgcaatccggcgtgatg
cccataactgaaaacagcctggatgccgaacaaggtttagttataccgccgtttgtggag
ccacatattcacctggacaccacgcaaaccgccggacaaccgaactggaatcagtccggc
acgctgtttgaaggcattgaacgctgggccgagcgcaaagcgttattaacccatgacgat
gtgaaacaacgcgcatggcaaacgctgaaatggcagattgccaacggcattcagcatgtg
cgtacccatgtcgatgtttcggatgcaacgctaactgcgctgaaagcaatgctggaagtg
aagcaggaagtcgcgccgtggattgatctgcaaatcgtcgccttccctcaggaagggatt
ttgtcgtatcccaacggtgaagcgttgctggaagaggcgttacgcttaggggcagatgta
gtgggggcgattccgcattttgaatttacccgtgaatacggcgtggagtcgctgcataaa
accttcgccctggcgcaaaaatacgaccgtctcatcgacgttcactgtgatgagatcgat
gacgagcagtcgcgctttgtcgaaaccgttgctgccctggcgcaccatgaaggcatgggc
gcgcgagtcaccgccagccacaccacggcaatgcactcctataacggggcgtatacctca
cgcctgttccgcttgctgaaaatgtccggtattaactttgtcgccaacccgctggtcaat
attcatctgcaaggacgtttcgatacgtatccaaaacgtcgcggcatcacgcgcgttaaa
gagatgctggagtccggcattaacgtctgctttggtcacgatgatgtcttcgatccgtgg
tatccgctgggaacggcgaatatgctgcaagtgctgcatatggggctgcatgtttgccag
ttgatgggctacgggcagattaacgatggcctgaatttaatcacccaccacagcgcaagg
acgttgaatttgcaggattacggcattgccgccggaaacagcgccaacctgattatcctg
ccggctgaaaatgggtttgatgcgctgcgccgtcaggttccggtacgttattcggtacgt
ggcggcaaggtgattgccagcacacaaccggcacaaaccaccgtatatctggagcagcca
gaagccatcgattacaaacgttga
              
                            

Download fasta file
RegulonDB