RegulonDB RegulonDB 10.8: Gene Sequence
codB gene sequence


Size: 1260        A: 216  T: 365  G: 369  C: 310

Fasta

 

>codB E. coli K12. Version NC_000913.3 GI:556503834
gtgtcgcaagataacaactttagccaggggccagtcccgcagtcggcgcggaaaggggta
ttggcattgacgttcgtcatgctgggattaaccttcttttccgccagtatgtggaccggc
ggcactctcggaaccggtcttagctatcatgatttcttcctcgcagttctcatcggtaat
cttctcctcggtatttacacttcatttctcggttacattggcgcaaaaaccggcctgacc
actcatcttcttgctcgcttctcgtttggtgttaaaggctcatggctgccttcactgcta
ctgggcggaactcaggttggctggtttggcgtcggtgtggcgatgtttgccattccggtg
ggtaaggcaaccgggctggatattaatttgctgattgccgtttccggtttactgatgacc
gtcaccgtcttttttggcatttcggcgctgacggttctttcggtgattgcggttccggct
atcgcctgcctgggcggttattccgtgtggctggctgttaacggcatgggcggcctggac
gcattaaaagcggtcgttcccgcacaaccgttagatttcaatgtcgcgctggcgctggtt
gtggggtcatttatcagtgcgggtacgctcaccgctgactttgtccggtttggtcgcaat
gccaaactggcggtgctggtggcgatggtggcctttttcctcggcaactcgttgatgttt
attttcggtgcagcgggcgctgcggcactgggcatggcggatatctctgatgtgatgatt
gctcagggcctgctgctgcctgcgattgtggtgctggggctgaatatctggaccaccaac
gataacgcactctatgcgtcgggtttaggtttcgccaacattaccgggatgtcgagcaaa
accctttcggtaatcaacggtattatcggtacggtctgcgcattatggctgtataacaat
tttgtcggctggttgaccttcctttcggcagctattcctccagtgggtggcgtgatcatc
gccgactatctgatgaaccgtcgccgctatgagcactttgcgaccacgcgtatgatgagt
gtcaattgggtggcgattctggcggtcgccttggggattgctgcaggccactggttaccg
ggaattgttccggtcaacgcggtattaggtggcgcgctgagctatctgatccttaacccg
attttgaatcgtaaaacgacagcagcaatgacgcatgtggaggctaacagtgtcgaataa
              
                            

Download fasta file
RegulonDB