RegulonDB RegulonDB 10.8: Gene Sequence
gabD gene sequence


Size: 1449        A: 326  T: 278  G: 436  C: 409

Fasta

 

>gabD E. coli K12. Version NC_000913.3 GI:556503834
atgaaacttaacgacagtaacttattccgccagcaggcgttgattaacggggaatggctg
gacgccaacaatggtgaagccatcgacgtcaccaatccggcgaacggcgacaagctgggt
agcgtgccgaaaatgggcgcggatgaaacccgcgccgctatcgacgccgccaaccgcgcc
ctgcccgcctggcgcgcgctcaccgccaaagaacgcgccaccattctgcgcaactggttc
aatttgatgatggagcatcaggacgatttagcgcgcctgatgaccctcgaacagggtaaa
ccactggccgaagcgaaaggcgaaatcagctacgccgcctcctttattgagtggtttgcc
gaagaaggcaaacgcatttatggcgacaccattcctggtcatcaggccgataaacgcctg
attgttatcaagcagccgattggcgtcaccgcggctatcacgccgtggaacttcccggcg
gcgatgattacccgcaaagccggtccggcgctggcagcaggctgcaccatggtgctgaag
cccgccagtcagacgccgttctctgcgctggcgctggcggagctggcgatccgcgcgggc
gttccggctggggtatttaacgtggtcaccggttcggcgggcgcggtcggtaacgaactg
accagtaacccgctggtgcgcaaactgtcgtttaccggttcgaccgaaattggccgccag
ttaatggaacagtgcgcgaaagacatcaagaaagtgtcgctggagctgggcggtaacgcg
ccgtttatcgtctttgacgatgccgacctcgacaaagccgtggaaggcgcgctggcctcg
aaattccgcaacgccgggcaaacctgcgtctgcgccaaccgcctgtatgtgcaggacggc
gtgtatgaccgttttgccgaaaaattgcagcaggcagtgagcaaactgcacatcggcgac
gggctggataacggcgtcaccatcgggccgctgatcgatgaaaaagcggtagcaaaagtg
gaagagcatattgccgatgcgctggagaaaggcgcgcgcgtggtttgcggcggtaaagcg
cacgaacgcggcggcaacttcttccagccgaccattctggtggacgttccggccaacgcc
aaagtgtcgaaagaagagacgttcggccccctcgccccgctgttccgctttaaagatgaa
gctgatgtgattgcgcaagccaatgacaccgagtttggccttgccgcctatttctacgcc
cgtgatttaagccgcgtcttccgcgtgggcgaagcgctggagtacggcatcgtcggcatc
aataccggcattatttccaatgaagtggccccgttcggcggcatcaaagcctcgggtctg
ggtcgtgaaggttcgaagtatggcatcgaagattacttagaaatcaaatatatgtgcatc
ggtctttaa
              
                            

Download fasta file
RegulonDB