RegulonDB RegulonDB 10.8: Gene Sequence
gabP gene sequence


Size: 1401        A: 283  T: 399  G: 367  C: 352

Fasta

 

>gabP E. coli K12. Version NC_000913.3 GI:556503834
atggggcaatcatcgcaaccacatgagttaggcggcgggctgaagtcacgccacgtcacc
atgttgtctattgccggtgttatcggcgcaagtctgtttgtcggttccagcgtcgccatc
gccgaagcgggcccggcggtattactggcctatctgttcgccgggctactggtggttatg
attatgcggatgttggcggaaatggcggttgccacgcccgataccggttcgttttccacc
tatgccgataaagccattggtcgctgggcgggctataccatcggctggttgtactggtgg
ttttgggtactggttatcccgctggaagccaacatcgccgccatgatcctgcactcatgg
gttccaggcattcccatctggttattttccctcgtcattaccctcgccttaactggcagt
aacttattaagcgttaaaaactacggcgaatttgagttctggctggcgctgtgcaaagtc
atcgctatcctggcctttattttccttggtgcagtcgcaattagcggtttttacccgtat
gccgaagtgagcgggatctcaagattgtgggatagcggcggctttatgcccaacggtttc
ggtgcggtattaagcgcgatgttgatcaccatgttctcgtttatgggcgcagaaattgtc
accattgccgccgcggaatccgacacgccggaaaaacatattgtccgcgccaccaactcg
gttatctggcgtatttctatcttctatttatgttctatttttgtcgtcgtggcattaatt
ccgtggaatatgcccggactaaaagccgtcggttcttatcgctcggtactggaattgctc
aatattccccatgcgaaattaatcatggactgcgtgatattactttccgtaaccagttgc
ctgaactcggcgctgtataccgcgtcaaggatgctctactccttaagtcgtcgcggtgat
gctcccgcggtaatgggtaaaatcaaccgcagtaaaaccccgtacgtggcggtgttactc
tccaccggcgcggcattcttaacggtggtggtgaactattacgcgcctgcgaaggtattt
aaatttctgatcgacagctccggcgctatcgccctgctggtttatttagtcatcgccgtt
tcacagttgcggatgcgcaaaattctgcgagcagaaggaagcgaaattcgcttgcgaatg
tggctttatccgtggctcacctggctagtcatcggctttattacctttgtgttggtagtg
atgctattccgtccggcgcaacagttagaagtgatctccaccggcttattagcgataggg
attatctgtaccgtgccaattatggctcgctggaaaaagctggtattgtggcaaaaaaca
cccgttcataatacgcgctga
              
                            

Download fasta file
RegulonDB