RegulonDB RegulonDB 10.9: Gene Sequence
lysP gene sequence


Size: 1470        A: 279  T: 405  G: 420  C: 366

Fasta

 

>lysP E. coli K12. Version NC_000913.3 GI:556503834
atggtttccgaaactaaaaccacagaagcgccgggcttacgccgtgaattaaaggcgcgt
cacctgacgatgattgccattggcggttccatcggtacaggtctttttgttgcctctggc
gcaacgatttctcaggcaggtccgggcggggcattgctctcgtatatgctgattggcctg
atggtttacttcctgatgaccagtctcggtgaactggctgcatatatgccggtttccggt
tcgtttgccacttacggtcagaactatgttgaagaaggctttggcttcgcgctgggctgg
aactactggtacaactgggcggtgactatcgccgttgacctggttgcagctcagctggtc
atgagctggtggttcccggatacaccgggctggatctggagtgcgttgttcctcggcgtt
atcttcctgctgaactacatctcagttcgtggctttggtgaagcggaatactggttctca
ctgatcaaagtcacgacagttattgtctttatcatcgttggcgtgctgatgattatcggt
atcttcaaaggcgcgcagcctgcgggctggagcaactggacaatcggcgaagcgccgttt
gctggtggttttgcggcgatgatcggcgtagctatgattgtcggcttctctttccaggga
accgagctgatcggtattgctgcaggcgagtccgaagatccggcgaaaaacattccacgc
gcggtacgtcaggtgttctggcgaatcctgttgttctatgtgttcgcgatcctgattatc
agcctgattattccgtacaccgatccgagcctgctgcgtaacgatgttaaagacatcagc
gttagtccgttcaccctggtgttccagcacgcgggtctgctctctgcggcggcggtgatg
aacgcagttattctgacggcggtgctgtcagcgggtaactccggtatgtatgcgtctact
cgtatgctgtacaccctggcgtgtgacggtaaagcgccgcgcattttcgctaaactgtcg
cgtggtggcgtgccgcgtaatgcgctgtatgcgacgacggtgattgccggtctgtgcttc
ctgacctccatgtttggcaaccagacggtatacctgtggctgctgaacacctccgggatg
acgggttttatcgcctggctggggattgccattagccactatcgcttccgtcgcggttac
gtattgcagggacacgacattaacgatctgccgtaccgttcaggtttcttcccactgggg
ccgatcttcgcattcattctgtgtctgattatcactttgggccagaactacgaagcgttc
ctgaaagatactattgactggggcggcgtagcggcaacgtatattggtatcccgctgttc
ctgattatttggttcggctacaagctgattaaaggaactcacttcgtacgctacagcgaa
atgaagttcccgcagaacgataagaaataa
              
                            

Download fasta file
RegulonDB