RegulonDB RegulonDB 10.9: Gene Sequence
waaG gene sequence


Size: 1125        A: 306  T: 315  G: 269  C: 235

Fasta

 

>waaG E. coli K12. Version NC_000913.3 GI:556503834
atgatcgtggcgttttgtttatataaatattttccatttggtgggcttcaacgtgacttt
atgcgcattgcatcaacagttgccgcacggggccaccatgttcgggtatatacacagtcg
tgggaaggcgattgcccgaaagcatttgagcttattcaggtgccagttaagtcccatacc
aaccatggacgcaatgcagaatattatgcctgggtacaaaatcatctcaaagagcatccc
gcagatcgcgttgttgggtttaataagatgcctggcctggatgtttattttgccgctgat
gtttgttacgccgagaaagttgcgcaagaaaaaggttttttatatcgtttaacatcacga
tatcgccattatgccgcatttgagcgagcgactttcgagcagggtaaatcgacgaaactt
atgatgctgaccgataagcaaatcgccgatttccagaagcattatcaaactgaacctgaa
cgttttcaaattcttcctcccggtatttatccggacagaaaatacagtgagcaaatccca
aacagccgtgaaatttatcgccagaaaaatggcataaaagagcaacaaaacttattactg
caggttggatcagattttggccgtaaaggtgtagatcgctcaattgaagctttggcatcg
ttaccggaatcattacgtcacaatacgcttttatttgttgttggtcaggataagccgcga
aaatttgaagcgctggcagaaaaactcggcgtgcggagcaatgtgcatttcttctccggt
cgcaatgatgtgtcagaattaatggcagccgctgatttattactgcatcccgcttatcag
gaagccgcgggtatcgttcttctagaagcgatcactgctgggttacctgttttaacaaca
gcggtatgtgggtacgcgcattatattgcggatgccaattgtggaacggtcatcgctgaa
cctttctctcaggaacaattaaatgaagttttacgtaaagcgttaactcagtcgccattg
cgaatggcctgggcggagaatgctcgccattatgccgatactcaggatttgtatagcttg
ccagaaaaagccgcggatatcattacaggtggtttagatggttga
              
                            

Download fasta file
RegulonDB