RegulonDB RegulonDB 10.9: Gene Sequence
waaQ gene sequence


Size: 1035        A: 291  T: 282  G: 248  C: 214

Fasta

 

>waaQ E. coli K12. Version NC_000913.3 GI:556503834
atgcgatatcatggggatatgttattaactactcctgtcatcagtacgctcaagcagaat
tatcctgatgcaaaaatcgatatgctgctttatcaggacaccatccctattttgtctgaa
aacccggaaattaatgcgctctatgggataagcaataaaggtgcgggaactttcgataaa
attaaaaatgtgctttcgttgataaaaactctgcgtgcgaataattatgacctggtcatt
aatcttacggatcagtggatggtggcgctgctggtacgttgtttacctgcacggatgaaa
atatcgcaactttatggtcatcggcagcatggtatttggaaaaaaagcttcacacactta
gcgccaatacacggtacacatattgttgagcgtaatttatcggtccttgagccattaggt
attaccgatttctacaccgacacaacaatgagttacgccgaagattgctggaagaagatg
cgccgggaattagatgccctgggcgtaaaagatcattatgttgtcatccaaccgacagcg
cgtcagatatttaagtgttgggataacgataaattttctaaggttatcgatgcgctgcaa
cagcgaggctatcaggttgtgctaacctgtgggccctcggcagatgatctcgcttgtgta
gatgagattgcacgaggttgcgaaacaaaacccattactggccttgcaggtaaaacacgt
tttcctgaactgggtgcattaattgatcatgcagtgctttttattggtgtggattctgcg
ccgggacatattgcagcggcagtgaaaacgccagtcattagtctatttggtgcaacggat
cacgtattctggcgtccctggaccgagaatattattcaattctgggcggggaattatcag
aaaatgccgacccggcatgaacttgaccgcaacaaaaaatatctttctgttatcccagcg
gaggatgtgatcgccgctacggaaaagctgttgccagaagatgccccttcagctgacagg
aatgcacaattatga
              
                            

Download fasta file
RegulonDB