RegulonDB RegulonDB 10.8: Gene Sequence
mnmA gene sequence


Size: 1107        A: 262  T: 250  G: 312  C: 283

Fasta

 

>mnmA E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaaaccgcaaaaaaagtaatcgtcggcatgtccggcggtgtcgattcctccgtt
tctgcctggctgttgcaacaacagggatatcaggtcgaaggcctgtttatgaagaactgg
gaagaagacgacggtgaggaatattgcacagcggcagcggatctggctgatgcccaggct
gtctgcgacaagctcggcattgaactgcacaccgttaactttgctgccgagtactgggac
aacgtcttcgaactgttccttgccgaatataaagccggtcgcacgccgaatccggatatt
ctgtgcaacaaagagatcaaatttaaagccttcctcgaatttgccgccgaagatttaggt
gccgattatatcgctaccggtcattacgtacgtcgggccgatgtcgatggcaagagccgc
ctgctgcgtggtctggacagcaataaagaccagagctacttcctttatacgctcagccat
gagcagattgcgcaaagcctgttcccggtcggcgaactggaaaaaccgcaggtgcgtaag
attgctgaagatcttggtctggtcaccgcgaagaaaaaagactctaccggcatttgcttc
attggcgaacgtaaattccgcgagttcctgggccgttatctcccggcgcaaccgggcaaa
atcattaccgtcgatggcgatgaaattggtgagcaccaggggctgatgtatcacactctc
ggtcagcgtaaaggtctgggtatcggtggcaccaaagaaggtaccgaagaaccgtggtat
gtggtggacaaagacgtcgaaaacaacattctggttgtcgctcagggccatgaacacccg
cggctgatgtctgtcgggttgattgcccagcagttgcactgggtcgatcgcgaaccattc
accggcactatgcgttgcacggtaaaaacccgctatcgccagaccgatatcccttgcacc
gtcaaggcgctggacgatgatcgcattgaagtgattttcgatgaaccggttgccgccgtg
acgccgggccagtctgccgtcttctataacggtgaagtgtgcctcggtggcggtattatt
gagcagcgtctgccgctgccggtctga
              
                            

Download fasta file
RegulonDB