RegulonDB RegulonDB 10.8: Gene Sequence
hflD gene sequence


Size: 642        A: 137  T: 138  G: 169  C: 198

Fasta

 

>hflD E. coli K12. Version NC_000913.3 GI:556503834
gtggcaaagaattactatgacatcaccctcgccctggccggtatttgtcagtcggcacgc
ctggtgcaacaactcgctcaccaggggcattgtgatgccgatgcgctacacgtctcactc
aacagtattattgatatgaaccccagctcgacgctggcggtttttggcggtagcgaagcc
aacctgcgcgtcgggctggaaaccctgctcggcgtgctcaatgccagcagtcgccagggc
ttaaacgccgaattaacccgctacacactcagcttgatggtgcttgagcgcaaactctcc
tcagcgaaaggcgcgctcgacactctgggcaaccggatcaacggcctgcaacgccagctc
gaacacttcgatttacagtccgaaacgctgatgagcgcgatggctgctatctatgttgat
gtgattagcccgcttggcccgcgcattcaggtcaccggttcccctgctgtactgcaaagc
ccacaagtgcaggcgaaagttcgcgcaaccctgctggcaggcattcgcgccgccgtgctc
tggcaccaggtcggcggcggacgtctgcaactgatgttttctcgtaatcgcctgaccact
caggcaaaacaaattcttgctcatttaaccccggagttgtga
              
                            

Download fasta file
RegulonDB