RegulonDB RegulonDB 10.9: Gene Sequence
waaB gene sequence


Size: 1080        A: 320  T: 332  G: 234  C: 194

Fasta

 

>waaB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatagcgtttatcggcgaagctgtttctggatttggcggcatggaaactgtcatc
cgtgatgttattactaccttcaggcaacaacatatccaaagtgaaatgtttttcttttgt
cgtaatgacaaaatggataagggatggctggaaggtattaaatactcatgttcattttcc
aatattcgtttaggttttttgcgtcgggcgaaacatattcatgctctaagtaaatggctt
caggagtaccaaccagatatcgttatttgtattgatgtgatctcctgcctgtttgccgca
aaagcacgtaaaaaatcaggaattgatatgccagtattttcatggccacatttttcttta
gatcacaaaaaacatgctgaatatatcacctgtgccgactatcatttagcaatcagctct
ggcattaaacagcaaatgattaatcgaggtgtagcagaatcgacgataaatgttattttt
aatcccgtcgaaactaaagactcagtcattcccgcgcccgaggaaggtgaaacggcaacg
tttatttatgttgggcgtatgaaatttgaaggccagaaaagagttaaagacctgcttgat
ggcttatcacaagcgaaaggtaactggaaactccatgtattgggtgatggctccgatttc
gaaaaatgccaggcttatggtagagaattaaatattgatgatcgaattgtctggtatggt
tggcaacaatatccctgggaattggtccagcaagatattgaaaaagtgagtgcgttattg
ctcacgtcatcttttgaaggtttcccaatgaccctacttgaagccttgtcgtgggggatt
ccttgtatcagtgccgattgtgtctccgggcctgctgacattattcaacctgatgtcaat
ggccatctgtatcaaccgggagatattgctggttttgtaactcttctaaataaatatata
gcaggtgaaattcatatcgaacatgaaaaaattcctgcgtcgatcgatgaattttaccaa
tcgaagtattacgatagattacataaggtaattatttctgctatttcccggaggaaataa
              
                            

Download fasta file
RegulonDB