RegulonDB RegulonDB 10.9: Gene Sequence
waaO gene sequence


Size: 1020        A: 326  T: 325  G: 197  C: 172

Fasta

 

>waaO E. coli K12. Version NC_000913.3 GI:556503834
atgcagcaggtgtttttccaggaaactgagtttcttaattcagttattgattatgatcat
aaagtagaaacagaaaatctttgtctggacatcgcttatggaactgacaaaaactttcta
tttggttgcggaatttcgattgcttcaatattaaaatataatgaaggaagtcgattgtgt
ttccatatttttactgattattttggtgatgatgatcgtaagtattttgatgccctggcg
ttgcagtataaaaccagaattaaaatatatctgattaatggtgatcgactgcgctcattg
cctagcactaagaattggactcatgcaatatattttcgttttgttattgcagattacttt
attaataaggcgcctaaagtcctttatctggatgcagatatcatttgtcaggggactatt
gagccactaattaatttctcatttcctgacgataaagtcgcaatggttgttacagaaggg
caagctgactggtgggaaaaacgcgcccattcgttaggtgttgcgggaattgctaaaggt
tactttaactccggttttttattgattaatactgcccaatgggcggctcagcaggtttct
gcacgagctattgcaatgctaaatgagccagaaataatcaaaaaaataacacatcctgat
caggatgtgttaaatatgttgctggcggataaacttattttcgctgatattaaatataac
acccagttcagcttaaattatcaactcaaagaaagctttataaacccagtaaccaacgat
actatttttatccattatatcgggccaaccaagccctggcatgattgggcctgggattat
cctgtatcacaagcctttatggaggcaaaaaatgcttcgccatggaagaatacggcgttg
ctgaaaccgaacaatagcaatcaattaagatatagcgcaaaacatatgcttaaaaagcat
agatatctaaaaggatttagcaactatcttttttattttattgaaaagataaagcattaa
              
                            

Download fasta file
RegulonDB