RegulonDB RegulonDB 10.9: Gene Sequence
waaJ gene sequence


Size: 1017        A: 337  T: 336  G: 186  C: 158

Fasta

 

>waaJ E. coli K12. Version NC_000913.3 GI:556503834
gtggactcatttcctgccatagagatagataaagttaaagcctgggattttcggctagct
aatataaatacttctgaatgtttaaatgttgcctatggtgtcgatgctaattatcttgat
ggtgtaggtgtttccatcacatcaattgtcctaaataatcgacatattaatcttgatttt
tatattattgctgatgtttataatgatggtttttttcaaaaaattgcaaagcttgcagag
caaaaccaattaagaatcacgttatatagaattaacactgataagctccagtgcttgcct
tgtacacaggtctggtcaagagcaatgtacttccgtttatttgcatttcaattattgggt
ttaacgcttgatcgtttgctttatcttgatgcagatgttgtttgtaaaggcgatattagc
caactattacatctgggtttaaatggagcggttgctgctgttgttaaagatgttgagcca
atgcaagaaaaggcggtatccaggttgtctgatcctgaattacttgggcagtactttaat
tccggtgtcgtttatttagacttaaaaaaatgggctgacgcaaaactaacagaaaaagcg
ttgtctattcttatgagtaaagataatgtttataaataccctgatcaggatgttatgaat
gtcttactgaaagggatgacattatttttgcctcgtgagtacaatacaatttatacaatt
aaaagtgaattaaaagacaaaacacatcaaaactataaaaagctgattacagaaagtact
cttcttattcattatacaggtgcaactaaaccgtggcacaaatgggcaatttatccatcg
gtaaaatactataaaatagctttagaaaattccccctggaaagatgactctccacgagat
gcgaaatcaattattgaatttaaaaaaagatataaacatcttttagtgcaacatcattat
atctcaggaattatagcaggagtctgttatctttgccgaaaatattaccgtaaataa
              
                            

Download fasta file
RegulonDB