RegulonDB RegulonDB 10.9: Gene Sequence
asmA gene sequence


Size: 1854        A: 470  T: 410  G: 528  C: 446

Fasta

 

>asmA E. coli K12. Version NC_000913.3 GI:556503834
atgagacgatttctgacgacgctgatgatactcctggtcgtgctggtggccgggttatct
gcgttagtgttgctggtgaatccgaatgatttccgcgactatatggtcaagcaagttgct
gcacgtagcggttatcaattgcagctcgacgggccactgcgttggcacgtctggccgcag
cttagtatcctctccgggcgaatgtctctcaccgcccagggcgcaagccagccactggtt
cgcgccgacaacatgcgtctggacgtggcgcttttaccactactgagtcatcaactgagc
gttaagcaggtgatgctaaaaggggcagtgatccaactgacgccgcagacggaagcggtg
cgcagtgaagacgctccggttgcaccgcgcgacaataccttgccggatctgtcagacgat
cgcggatggtcgtttgatatatccagtcttaaggtggcggacagcgtgctggtgttccag
catgaagatgacgagcaggtgacaatccgcaatattcgcctgcaaatggaacaagatccc
caacatcgtggttcatttgagttctccgggcgggttaatcgcgatcagcgcgatctcacg
atatcccttaacggtacggtagatgcttctgattatccgcatgatttaacggcggctatt
gaacaaattaactggcagttgcagggtgccgatttaccaaaacaaggtattcaggggcag
gggagtttccaggcccagtggcaggagtcacataaacgcctttcatttaaccaaattagt
ttgaccgccaatgatagtacgctaagcgggcaagcacaggttacgctgacagagaaaccg
gaatggcagctgaggctgcaattcccgcaactgaatcttgacaacctcatcccgcttaat
gaaaccgcgaatggtgaaaacggtgccgcgcagcaggggcagagccaatcaacgttgccg
cgcccggtcatttcttcgcgtattgatgaaccggcctatcagggactgcaaggctttacg
gctgatattttgttgcaggccagtaacgtgcgctggcgcggaatgaattttacagatgtt
gccacgcaaatgaccaacaagtcgggtttgctggaaattactcaactgcagggcaaactt
aacggtggacaggtttcactgccgggcacgctggacgcgacatcaataaatccgcggata
aacttccagccacggctggaaaacgttgagattggtaccattctgaaggcgtttaactat
ccgatttcgttgaccggaaaaatgtcactggctggtgatttctccggtgctgacatagat
gccgacgcattccgccacaactggcaaggacaggcacatgtcgaaatgaccgacacgcgc
atggaagggatgaacttccagcagatgattcagcaagcggtagagcgtaatggcggtgat
gtgaaggccgctgaaaactttgataacgtgacgcggcttgaccgctttaccaccgatttg
acgttgaaggatggcgtcgtgacgttaaacgacatgcaaggtcaatcgcctgtgctggcg
ctgacaggggaaggcatgttgaatctggcagatcaaacctgcgacacccagtttgatatt
cgggtcgtgggtggctggaacggggaaagcaaactgattgatttcctgaaagaaacgcca
gtaccgctgcgggtttatggcaactggcagcaactcaattacagcctgcaagtggatcag
ttactgcgcaaacatctacaggacgaagcgaaacgtcgcctgaatgactgggccgagcgg
aataaagattcccgtaatggcaaagatgtgaagaagttgctggagaagatgtag
              
                            

Download fasta file
RegulonDB