RegulonDB RegulonDB 10.8: Gene Sequence
barA gene sequence


Size: 2757        A: 717  T: 666  G: 698  C: 676

Fasta

 

>barA E. coli K12. Version NC_000913.3 GI:556503834
atgaccaactacagcctgcgcgcacgcatgatgattctgatcctggcaccgaccgtcctt
attggtttattgctgagtatctttttcgtcgtgcatcgctataacgacttgcagcgtcaa
ctggaagatgccggtgccagcattattgagccgcttgcagtttctactgaatatggcatg
agcctgcaaaatcgcgaatctatcggtcagttaataagcgtactgcatcgtcgccattcc
gatattgttcgcgcgatttcggtttatgatgaaaataaccgactctttgtcacctccaat
tttcatcttgatccctcatcaatgcagctcggcagcaacgtgccgtttcctcgccagctc
actgtcactcgtgacggcgatattatgatcctccgcacgccgattatttctgagagttac
tcccccgacgaatcgcccagtagcgatgccaaaaatagtcaaaatatgttgggatatatt
gcgctggagctggatcttaaatcggttcgcttgcagcaatataaagagatctttatttcc
agcgtgatgatgctgttttgtatcggtattgcgcttatttttggctggcgcttaatgcgc
gatgtaaccggtccgattcgcaacatggtgaataccgtcgaccgcatccgtcgcgggcaa
ctcgacagccgggtggaaggatttatgctcggcgagctggatatgctgaaaaacggtatc
aactcgatggcaatgtcgctggctgcttatcacgaagagatgcagcacaatatcgaccag
gcgacgtccgatctgcgtgaaacgctggagcagatggaaattcagaacgttgagttagat
ctggcgaaaaagcgcgcccaggaagcggcgcgtattaaatccgagtttctggcaaatatg
tcacacgagctgcgtacaccactgaatggtgttattggctttacccgcctgacgctgaaa
acagaattaacaccaacgcagcgcgatcacctgaatacgattgaacgttcggcaaataat
ttgctggcaattattaatgatgttctcgacttctcgaaactggaagcaggtaagctgatt
ctggaaagtattccattcccactacgcagcacgctggatgaagtcgttactctgctggca
cattcttctcacgataaagggttagaactgacgctcaatattaaaagcgacgtgcctgat
aacgtgatcggcgacccgctgcgattacagcaaatcatcactaacctggtggggaatgca
attaaattcaccgagaatggcaacattgatattctggtagaaaaacgtgcgctgagtaat
accaaagtgcagattgaagtgcagattcgggataccggcattggtattcctgaacgcgat
caatcgcgcttattccaggccttccgacaggctgatgccagtatttcccgccgtcatggt
ggcaccgggctggggctggtgattacacaaaaactggttaatgaaatgggcggcgatatt
tcgttccatagccagccgaatcgcggttcaactttctggttccacattaatctcgatctg
aacccgaacattattatcgaagggccatccacccagtgcctcgcaggtaagcgcctggcc
tatgtcgaaccaaactccgcagcagcgcaatgcacgctggatattttaagtgaaacgccg
ctggaagtggtttatagcccaacgttctccgcgctgcctcccgcgcattacgacatgatg
ttgttaggcatcgcggtgaccttccgcgagccgctaacaatgcaacatgagcgattagcg
aaagcggtatcgatgaccgatttcctgatgctggcacttccttgccatgcacaagtcaat
gctgaaaaactcaagcaagatggtatcggcgcgtgtctgctgaaaccattaacacctaca
cgcctgttgcctgccctgacggaattttgtcatcacaaacaaaacacgcttttgcctgta
accgatgaaagtaagctggcaatgacagtcatggcggttgatgacaaccccgctaacctg
aaacttatcggcgcattgctggaagatatggtgcaacatgtggaactttgcgatagcggg
catcaggcggttgaacgggcgaaacagatgccgttcgatttgatcttaatggatattcaa
atgccggacatggatggcattcgggcctgcgaactcatccaccaactcccgcatcagcaa
caaacgccggttatcgcggtaacggcgcatgcaatggccgggcaaaaagagaagctgctt
ggcgcagggatgagcgattatctggcgaaaccgattgaagaagagcgattgcataatttg
ttgttgcgctacaagcctggcagcggtatttcctctcgcgtcgtgacgcccgaagtcaac
gaaattgtggtgaacccgaatgcgaccctcgactggcaactggcactacgccaggcagca
ggaaaaaccgatttagcgcgcgatatgctgcaaatgttactcgatttcctgcctgaagtt
cgcaacaaagttgaggaacagctggttggagaaaacccggaaggcctggttgatttgatt
cataaactgcatggcagttgcggctatagcggtgtgccacgtatgaagaatctctgccaa
ctgatcgaacaacagctacgtagcggtactaaagaagaagatttggaaccggagctgctg
gaactgttggacgagatggataatgtcgcgcgcgaagccagcaaaattctcgggtaa
              
                            

Download fasta file
RegulonDB