RegulonDB RegulonDB 10.8: Gene Sequence
tadA gene sequence


Size: 504        A: 116  T: 112  G: 158  C: 118

Fasta

 

>tadA E. coli K12. Version NC_000913.3 GI:556503834
ttgtctgaagtcgaatttagccacgaatactggatgcgtcacgcgctgacgctggcgaaa
cgtgcctgggatgagcgggaagtgccggtcggcgcggtattagtgcataacaatcgggta
atcggcgaaggctggaaccgcccgattggtcgccatgatcccaccgcacatgcagaaatc
atggccctgcggcagggtggtctggtgatgcaaaattatcgtctgatcgacgccacgttg
tatgtcacgcttgaaccatgtgtaatgtgtgccggagcgatgatccacagtcgcattggt
cgcgtggtctttggtgcgcgtgacgcgaaaactggcgctgcgggatctttaatggatgtg
ctgcatcatccgggtatgaatcaccgagtggaaattacggaaggaatactggcggatgag
tgcgcggcgttgctcagtgacttctttcgcatgcgccgccaggaaattaaagcgcagaaa
aaagcgcaatcctcgacggattaa
              
                            

Download fasta file
RegulonDB