RegulonDB RegulonDB 10.8: Gene Sequence
mltF gene sequence


Size: 1557        A: 406  T: 366  G: 401  C: 384

Fasta

 

>mltF E. coli K12. Version NC_000913.3 GI:556503834
ttgaaaaaattaaagattaattatctgttcatcggcattctggcactgctgctcgcggtc
gctctctggccatccattccctggtttggtaaagccgacaaccgtatcgccgccattcaa
gcgcggggagagttgcgtgtgagcaccattcatactcccctgacttataacgaaatcaac
gggaaaccttttggcctggattacgaactggcgaaacagtttgccgattacctcggcgta
aaactgaaagtgaccgtgcggcagaatatcagccagctgtttgacgaccttgataatggt
aacgccgacctgctggcggcaggacttgtctataacagtgagcgggtaaaaaattatcag
cctggccctacctattattccgtgtcacaacaactggtttataaagtgggtcagtatcgc
ccacgtacgctgggcaacctgacggcggagcaactcaccgttgcaccgggtcatgtggtg
gttaacgatctccagaccctgaaagaaacaaaattcccggaattaagctggaaggtagac
gacaaaaaaggctctgcggaattaatggaagatgtcatcgaaggaaaactcgattacacc
attgctgattctgtcgccatcagcctgtttcagcgcgttcacccggagctcgccgtagcg
ctcgatatcaccgatgaacaaccggtgacttggtttagcccgttagatggcgataatacc
ctttccgccgccctgctcgacttcttcaacgaaatgaatgaagacggtacgctggcacgc
attgaagagaaatacctggggcatggcgatgattttgattacgtcgatacgcgcacattt
ttacgcgccgtcgatgcggtactgccgcagttaaagcccctgtttgagaaatacgccgaa
gaaattgactggcgtttgctggccgctattgcttatcaggaatcgcactgggatgcacag
gccacttcaccgacgggtgtgcgcggcatgatgatgttaaccaaaaataccgcgcaaagc
ctcggcattacggatcgtaccgatgccgaacagagcatcagcggtggcgtgcgttatttg
caggatatgatgagtaaagtgccggaaagtgtgccggagaacgagcggatctggtttgcc
ctcgctgcgtacaatatgggctatgcgcatatgctggatgcccgcgccctgacggcaaaa
accaaagggaatcctgacagttgggctgacgtaaaacagcgtctgcctttacttagccag
aaaccctattacagcaagctgacttacggctacgctcgtggacatgaagcctacgcttat
gtcgaaaatattcgtaagtatcagattagcctggtgggttatctgcaagagaaagagaag
caggctacagaagcggcgatgcaactggcgcaggattatccggcggtatcgcctacggag
ttgggcaaagagaaatttccttttctctcgtttctttcccagtcgtcatcaaactatttg
acccattctccctctctgctgttttccaggaaagggagtgaagagaaacaaaattaa
              
                            

Download fasta file
RegulonDB