RegulonDB RegulonDB 10.9: Gene Sequence
ahpC gene sequence


Size: 564        A: 159  T: 123  G: 131  C: 151

Fasta

 

>ahpC E. coli K12. Version NC_000913.3 GI:556503834
atgtccttgattaacaccaaaattaaaccttttaaaaaccaggcattcaaaaacggcgaa
ttcatcgaaatcaccgaaaaagataccgaaggccgctggagcgtcttcttcttctacccg
gctgactttactttcgtatgcccgaccgaactgggtgacgttgctgaccactacgaagaa
ctgcagaaactgggcgtagacgtatacgcagtatctaccgatactcacttcacccacaaa
gcatggcacagcagctctgaaaccatcgctaaaatcaaatatgcgatgatcggcgacccg
actggcgccctgacccgtaacttcgacaacatgcgtgaagatgaaggtctggctgaccgt
gcgaccttcgttgttgacccgcagggtatcatccaggcaatcgaagttaccgctgaaggc
attggccgtgacgcgtctgacctgctgcgtaaaatcaaagcagcacagtacgtagcttct
cacccaggtgaagtttgcccggctaaatggaaagaaggtgaagcaactctggctccgtct
ctggacctggttggtaaaatctaa
              
                            

Download fasta file
RegulonDB