RegulonDB RegulonDB 10.9: Gene Sequence
ahpF gene sequence


Size: 1566        A: 408  T: 326  G: 436  C: 396

Fasta

 

>ahpF E. coli K12. Version NC_000913.3 GI:556503834
atgctcgacacaaatatgaaaactcaactcaaggcttaccttgagaaattgaccaagcct
gttgagttaattgccacgctggatgacagcgctaaatcggcagaaatcaaggaactgttg
gctgaaatcgcagaactgtcagacaaagtcacctttaaagaagataacagcttgccggtg
cgtaagccgtctttcctgatcaccaacccaggttccaaccaggggccacgttttgcaggc
tccccgctgggccacgagttcacctcgctggtactggcgttgctgtggaccggtggtcat
ccgtcgaaagaagcgcagtctctgctggagcagattcgccatattgacggtgattttgaa
ttcgaaacctattactcgctctcttgccacaactgcccggacgtggtgcaggcgctgaac
ctgatgagcgtactgaacccgcgcatcaagcacactgcaattgacggcggcaccttccag
aacgaaatcaccgatcgcaacgtgatgggcgttccggcagtgttcgtaaacgggaaagag
tttggtcagggccgcatgacgttgactgaaatcgttgccaaaattgatactggcgcggaa
aaacgtgcggcagaagagctgaacaagcgtgatgcttatgacgtattaatcgtcggttcc
ggcccggcgggtgcagcggcagcaatttactccgcacgtaaaggcatccgtaccggtctg
atgggcgaacgttttggtggtcagatcctcgataccgttgatatcgaaaactacatttct
gtaccgaagactgaagggcagaagctggcaggcgcactgaaagttcacgttgatgaatac
gacgttgatgtgatcgacagccagagcgccagcaaactgatcccagcagcagttgaaggt
ggtctgcatcagattgaaacagcttctggcgcggtactgaaagcacgcagcattatcgtg
gcgaccggtgcaaaatggcgcaacatgaacgttccgggcgaagatcagtatcgcaccaaa
ggcgtgacctactgcccgcactgcgacggcccgctgtttaaaggtaaacgcgtagcggtt
atcggcggcggtaactccggcgtggaagcggcaattgacctggcgggtatcgttgagcac
gtaacgctgctggaatttgcgccagaaatgaaagccgaccaggttctgcaggacaaactg
cgcagcctgaaaaacgtcgacattattctgaatgcgcaaaccacggaagtgaaaggcgac
ggcagcaaagtcgttggtctggaatatcgagatcgtgtcagcggcgatattcacaacatc
gaactggccggtattttcgtccagattggtctgctgccgaacaccaactggctcgaaggc
gcagtcgaacgtaaccgcatgggcgagattatcattgatgcgaaatgcgaaaccaacgtg
aaaggcgtgttcgcagcgggtgactgtacgacggttccgtacaagcagatcatcatcgcc
actggcgaaggtgccaaagcctctctgagtgcttttgactacctgattcgcaccaaaact
gcataa
              
                            

Download fasta file
RegulonDB