RegulonDB RegulonDB 10.8: Gene Sequence
nhaB gene sequence


Size: 1542        A: 287  T: 440  G: 411  C: 404

Fasta

 

>nhaB E. coli K12. Version NC_000913.3 GI:556503834
atggagatctcctggggccgcgcgctatggcgcaattttttgggccagtcccccgactgg
tacaaactcgccctcatcattttcttaatcgtaaacccgttaattttcctcatcagccct
ttcgtcgcgggctggttgctggtagcggaatttattttcactctggcgatggccctgaaa
tgctacccgctgctccccggtggtctgttggctatcgaagcggtattcatcggcatgacc
agcgcggaacacgtccgtgaagaggtggcggcaaatcttgaagtcttgctgttactgatg
tttatggtggcgggtatctattttatgaaacagctgttgctgttcatatttacccgtttg
ctgttaagcattcgctccaaaatgctgctgtcgctctctttttgcgtggcggctgcgttc
ctctccgcgttcctcgatgccttaaccgtcgtggcggtggtgatcagcgttgcagtcggt
ttttatggtatttatcaccgcgtagcctcttcccgtaccgaagacaccgacctgcaagac
gatagtcatatcgacaagcattacaaagtggttctggaacagttccgtggctttctgcgt
agcctgatgatgcatgccggtgtcggcaccgcattaggcggcgtaatgaccatggtgggc
gaaccacagaacctgatcatcgctaaagcggctggctggcattttggcgatttcttcctg
cgcatgtcgccggtgaccgttccggttctgatttgtggcctgttaacctgcctgctggta
gagaagctgcgttggtttggctacggtgaaacgctgccggagaaagtccgcgaagtgttg
caacagtttgacgatcaaagccgccaccagcgtacccgtcaggataaaatccgtctgatt
gtccaggcgattattggcgtctggctggtgactgcgctggcgttgcatctggcggaagtt
ggcttgattggtttgtcagtcattattctggcaacatcattgaccggtgtcaccgatgag
catgctatcggtaaagccttcaccgaatctctgccattcaccgcactgttgacggtgttt
ttctcggtagtcgcggtgattatcgaccaacaactgttttcgccaattattcagtttgtg
ttgcaggcatcggaacatgctcagctgtcgctgttctatattttcaacggtctgctgtca
tccatttcggataacgtcttcgtggggacgatttatatcaacgaagcgaaagcggcaatg
gaaagtggcgctatcacgttgaagcaatacgagctgctggcggtcgccattaataccggt
accaatctgccctccgtcgctacgccgaacggtcaggctgcgttcctgttcctgctgacc
tctgcactcgcgccattgattcgcctctcttatggccgcatggtgtggatggccctgcct
tacaccctcgtcctgacactcgtcggcttgctctgcgtcgagtttacgcttgcccctgta
accgaatggtttatgcaaatgggctggatagcaacgctttga
              
                            

Download fasta file
RegulonDB