RegulonDB RegulonDB 10.10: Gene Sequence
hdeA gene sequence


Size: 333        A: 108  T: 82  G: 79  C: 64

Fasta

 

>hdeA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagtattaggcgttattcttggtggtctgcttcttctgccagttgtgagcaat
gcagcggatgcgcaaaaagcagctgataacaaaaaaccggtcaactcctggacctgtgaa
gatttcctggctgtggacgaatccttccagccaactgcagttggttttgctgaagcgctg
aacaacaaagataaaccagaagatgcggttttagatgttcagggtattgcaaccgtaacc
ccagctatcgttcaggcttgtactcaggataaacaagccaactttaaagataaagttaaa
ggcgaatgggacaaaattaagaaagatatgtaa
              
                            

Download fasta file
RegulonDB