RegulonDB RegulonDB 10.9: Gene Sequence
dadX gene sequence


Size: 1071        A: 214  T: 236  G: 350  C: 271

Fasta

 

>dadX E. coli K12. Version NC_000913.3 GI:556503834
atgacccgtccgatacaggccagcctcgatctgcaggcattaaaacagaatctgtccatt
gtccgccaggccgcgacgcacgcgcgcgtctggtcggtggtaaaagcgaacgcttacggg
catggtattgagcgtatctggagcgcgatcggggccaccgatggctttgcattgcttaac
ctggaagaggcaataacgttacgtgagcgcggctggaaaggaccgatcctgatgctggaa
ggatttttccatgctcaggatctggagatttatgaccagcaccgcctgaccacctgcgta
cacagcaactggcagctcaaagcactgcaaaatgcgcggctaaaagcaccgttggatatt
tatcttaaagtgaacagtgggatgaatcggttgggcttccagcccgatcgcgtgcttacc
gtctggcagcagttgcgggcaatggcgaatgttggcgaaatgaccctgatgtcgcatttt
gccgaagcggaacatcctgatggaatttccggcgcgatggcgcgtattgagcaggcggcg
gaggggctggagtgtcggcgttcgttgtccaattcggcggcgactctgtggcacccggaa
gcgcattttgactgggttcggcctggcattattttgtatggcgcttcgccgtccggtcag
tggcgtgatatcgccaataccggattacgtccggtgatgacgctaagcagtgagattatt
ggtgtccagacgctaaaagcgggcgagcgtgtgggctacggcggtcgctatactgcgcgc
gatgaacagcgaatcggcattgtcgccgcagggtacgccgacggttatccgcgccacgcg
cctaccggtacccctgttttagtggacggcgtgcgcaccatgacggtggggaccgtctcg
atggatatgctagcggtcgatttaacgccttgcccgcaggcgggtattggtacgccggtt
gagctgtggggcaaggagatcaaaattgatgatgtcgccgccgctgccggaacggtgggc
tatgagttgatgtgcgcgctggcgctacgcgtcccggttgtgacggtgtaa
              
                            

Download fasta file
RegulonDB