RegulonDB RegulonDB 10.10: Gene Sequence
waaU gene sequence


Size: 1074        A: 382  T: 359  G: 162  C: 171

Fasta

 

>waaU E. coli K12. Version NC_000913.3 GI:556503834
atgcgcttaggaacttttcacaaaaagaaaagattttatataaacaaaatcaagattaat
ttcctttcttttttatttcgtaataaaataaataatcaaattacagatccagcacaagtt
aaatcatgccttattattcatgataataataaacttggtgatctaattgtattaagttcg
atttatcgtgaactttatagtaaaggggttaaaataactcttctcacaaatagaaagggt
ggggaatttctctctaataataaaaatatatttgagttctgtattaaagaatcaaccggt
tttcttgaaatgcttactctatgtaagcatctgcgggatttacagttcgatattgtatta
gacccctttgaaactatgccctcatttaagcatagcttaatattatcaagtttaaaagat
tcttacattctgggttttgatcattggtataagcgttactattcattttaccatccccac
gatgaatgtttaaaagaacatatgagtacacgagcaatagaaatactgaagcatatttat
ggtgagggtaaattttccaccaactacgacttgcatttaccagtagatgttgaagataaa
ataaaagaatttattggagatacaagaatagtcattattaatccattaggtgcaaaaaaa
atatgccgtcttacgtttgagcaaataaaagttatatatcaagaagtgaaaacacacttt
gaaaattatcggattatatttaccgggttaccgcaagatttattgacaataccaatactt
gaaatcgaaacactaccatttgatgagtttatttataccgttgcgttgaccaagtatagt
gattttgtcatttctgttgatacagctcttgttcatatcgctgcggcttatcataaacca
acgcttgcattttaccctaattcacgtactccggaatatccctcgcatttaatttggtcc
ccgaatcatcataaatctatacaaatagtatccccaacatatacggtaaaagatatcgat
actgaaactttaactaattcagtaaagagattaagttgtatagataagaagtga
              
                            

Download fasta file
RegulonDB