RegulonDB RegulonDB 10.10: Gene Sequence
waaL gene sequence


Size: 1260        A: 400  T: 458  G: 192  C: 210

Fasta

 

>waaL E. coli K12. Version NC_000913.3 GI:556503834
atgctaacatcctttaaacttcattcattgaaaccttacactctgaaatcatcaatgatt
ttagagataataacttatatattatgttttttttcaatgataattgcattcgtcgataat
actttcagcataaaaatatataatatcactgctatagtttgcttattgtcactaatttta
cgtggcagacaagaaaattataatataaaaaaccttattcttcccctttctatattttta
ataggcttgcttgatttaatttggtattctgcgtttaaagtagataattcgccatttcgt
gctacttaccatagttatttaaatactgccaaaatatttatatttggttcttttattgtt
ttcttgacactaactagccagctaaaatcaaaaaaagagagtgtattatacactttgtat
tctctgtcatttctaattgctggatatgcaatgtatattaatagcattcatgaaaatgac
cgcatttcttttggtgtaggaacggcaacaggagcagcatattcaacaatgctaataggg
atagttagtggcgttgcgattctttatactaagaaaaatcatccttttttatttttatta
aatagttgcgcggtactttatgttctggcgctaacacaaaccagagcaaccctactcctg
ttccctataatttgtgttgctgcattaatagcttattataataaatcacccaagaaattc
acttcctctattgttctactaattgctatattagctagcattgttattatatttaataaa
ccaatacagaatcgctataatgaagcattaaatgacttaaacagttataccaatgctaat
agtgttacttccctaggtgcaagactggcaatgtacgaaattggtttaaatatattcata
aagtcacctttttcatttagatcagcagagtcacgcgctgaaagtatgaatttgttagtt
gcagaacacaataggctaagaggggcattggagttttctaacgtacatctacataatgag
ataattgaagcagggtcactgaaaggtctgatgggaattttttccacacttttcctctat
ttttcactattttatatagcatataaaaaacgagctttgggtttgttgatattaacgctt
ggcattgtggggattggactcagtgatgtgatcatatgggcacgcagcattccaattatc
attatatccgctatagtcctcttactcgtcattaataatcgtaacaatacaattaattaa
              
                            

Download fasta file
RegulonDB