RegulonDB RegulonDB 10.8: Gene Sequence
yfeD gene sequence


Size: 393        A: 127  T: 85  G: 94  C: 87

Fasta

 

>yfeD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagattacgcaataaaatgaccaccgaagaactggctgaatgcctcggtgtggct
aaacaaactgttaaccgttggatcagagaaaaaggctggaaaacggaaaaatttcccggc
gtgaaaggcggtcgtgccagacttattctggtcgatacgcaagtttgcgagtttattcag
aacacgccagccttccataacacaccaatgttgatggaagctgaagagagaattgctgaa
tacgctcctggagcacgcgccccggcgtatcgacaaatcatcaacgcgatagataatatg
acagacattgagcaggaaaaagtcgcgcaatttttgtcacgtgaaggaattcgcaatttc
ctcgcccgtctcgatattgacgaatcagcataa
              
                            

Download fasta file
RegulonDB