RegulonDB RegulonDB 10.8: Gene Sequence
yceF gene sequence


Size: 585        A: 147  T: 145  G: 154  C: 139

Fasta

 

>yceF E. coli K12. Version NC_000913.3 GI:556503834
atgcctaaacttattttagcctccacctcgccatggcgtcgcgctcttctggaaaaactg
caaatctcttttgaatgtgcagcaccagaggtcgacgaaaccccacgcagcgacgaatca
ccgcgacagttggtgcttcgactggcacaagaaaaagcgcaatctctggcgtcacgttat
ccggatcatttaattattggttcagaccaggtatgtgttcttgatggcgaaatcaccggt
aaaccgttaacggaagaaaatgcccgtctgcaattacgcaaagccagcggcaatatcgtc
accttctatactggactggcgttgtttaattcggcgaatgggcatctgcaaacagaagtg
gagccttttgacgtccatttccgtcacctgagcgaggcggagattgataattacgtgcgt
aaagagcatcccctgcactgcgcgggtagctttaagagtgaaggatttggcattacgctg
tttgagcgtttagaggggcgtgatcctaacacgctggttggtttaccgctaatcgcgctg
tgtcagatgttacgtcgggaagggaaaaacccgctgatgggatag
              
                            

Download fasta file
RegulonDB