RegulonDB RegulonDB 10.9: Gene Sequence
emrB gene sequence


Size: 1539        A: 281  T: 387  G: 457  C: 414

Fasta

 

>emrB E. coli K12. Version NC_000913.3 GI:556503834
atgcaacagcaaaaaccgctggaaggcgcgcaactggtcattatgacgattgcgctgtca
ctggcgacattcatgcaggtgctggactccaccattgctaacgtggcgatccccactatc
gccgggaatctgggctcatcgctcagccagggaacgtgggtaatcacttctttcggggtg
gcgaatgccatctcgatcccgcttaccggctggctggcaaagcgcgtcggggaagtgaaa
ctgttcctttggtccaccatcgcctttgctattgcgtcgtgggcgtgtggtgtctccagc
agcctgaatatgctgatcttcttccgcgtgattcaggggattgtcgccgggccgttgatc
ccgctttcgcaaagtctattgctgaataactacccgccagccaaacgctcgatcgcgctg
gcgttgtggtcgatgacggtgattgtcgcgccaatttgcggcccgatcctcggcggttat
atcagcgataattaccactggggctggatattcttcatcaacgtgccgattggcgtggcg
gtggtgttgatgacactgcaaactctgcgcggacgtgaaacccgcaccgaacggcggcgg
attgatgccgtggggctggcactgctggttattggtatcggcagcctgcagattatgctc
gaccgcggtaaagagctggactggttttcatcacaggaaattatcatccttaccgtggtg
gcggtggtggctatctgcttcctgattgtctgggagctgaccgacgataacccgatagtc
gatctgtcgttgtttaagtcgcgcaacttcaccatcggctgcttgtgtatcagcctcgcg
tatatgctctacttcggcgctattgttctgctgccgcagttgttgcaggaggtctacggt
tacacggcgacctgggcaggtttggcctctgcgccggtagggattattccggtgatcctg
tcgccgattatcggccgcttcgcgcataaactggatatgcggcggctggtaaccttcagc
tttattatgtatgccgtctgcttctactggcgtgcctatacctttgaaccaggtatggat
tttggcgcgtcggcctggccgcagtttatccaggggtttgcggtggcctgcttctttatg
ccgctgaccaccattacgctgtctggtttgccaccggaacgactggcggcggcatcgagc
ctctctaactttacgcgaacgctggcggggtctatcggcacgtcgataaccacgaccatg
tggaccaaccgcgagtcgatgcaccatgcgcagttgactgagtcggtaaacccgttcaac
ccgaatgcccaggcgatgtacagtcaactggaagggcttgggatgacgcaacagcaggca
tcaggctggattgcccagcagatcaccaatcaggggctgattatttccgccaatgagatc
ttctggatgtcagccgggatattcctcgtcctgctggggctggtgtggtttgctaaaccg
ccatttggcgcaggtggcggcggaggcggtgcgcactaa
              
                            

Download fasta file
RegulonDB