RegulonDB RegulonDB 10.9: Gene Sequence
pabC gene sequence


Size: 810        A: 185  T: 215  G: 231  C: 179

Fasta

 

>pabC E. coli K12. Version NC_000913.3 GI:556503834
atgttcttaattaacggtcataagcaggaatcgctggcagtaagcgatcgggcaacgcag
tttggtgatggttgttttaccaccgccagagttatcgacggtaaagtcagtttgttatcg
gcgcatatccagcgactacaggatgcttgtcagcggttgatgatttcctgtgacttctgg
cctcagcttgaacaagagatgaaaacgctggcagcagaacagcaaaatggtgtgctgaaa
gtcgtgatcagtcgcggtagtggcgggcgagggtacagcacattgaacagcggaccggca
acgcggattctctccgttacggcttatcctgcacattacgaccgtttgcgtaacgagggg
attacgttggcgctaagcccggtgcggctggggcgcaatcctcatcttgcaggtattaaa
catctcaatcgtcttgagcaagtattgattcgctctcatcttgagcagacaaacgctgat
gaggcgctggtccttgacagcgaagggtgggttacggaatgctgtgcggctaatttgttc
tggcggaagggcaacgtagtttatacgccgcgactggatcaggcaggtgttaacggcatt
atgcgacaattctgtatccgtttgctggcacaatcctcttatcagcttgtcgaagtgcaa
gcctctctggaagagtcgttgcaggcagatgagatggttatttgtaatgcgttaatgcca
gtgatgcccgtatgtgcctgtggcgatgtctccttttcgtcagcaacgttatatgaatat
ttagccccactttgtgagcgcccgaattag
              
                            

Download fasta file
RegulonDB