RegulonDB RegulonDB 11.0: Gene Sequence
hdeD gene sequence


Size: 573        A: 112  T: 194  G: 147  C: 120

Fasta

 

>hdeD E. coli K12. Version NC_000913.3 GI:556503834
atgttatatatagataaggcaacaattttgaagtttgatctggagatgcttaaaaaacat
cgcagagcaatccagtttattgccgtgctgctgtttatcgtcgggttgctgtgtatcagt
ttcccgttcgtctctggcgatattttaagcacagtagtgggtgcattattaatctgctcg
ggtattgcgcttattgtcgggttattcagcaaccgcagtcataatttctggccggtatta
tccggtttcctcgtcgcagtcgcctatttattgatcggctatttcttcatccgcgcaccg
gagctgggcatttttgccattgcggcatttattgccggtttgttctgtgttgcaggggtt
attcgcctgatgagttggtatcgtcagcgttcaatgaaaggcagctggctacagctcgtt
attggtgtgctggatatcgtcattgcctggatattccttggtgcaacgccgatggtgtct
gtaacgctggtttccacactggtgggaattgaactgatatttagcgccgccagcctgttc
agcttcgccagtttgttcgttaagcagcaataa
              
                            

Download fasta file
RegulonDB