RegulonDB RegulonDB 10.9: Gene Sequence
ftsH gene sequence


Size: 1935        A: 462  T: 436  G: 561  C: 476

Fasta

 

>ftsH E. coli K12. Version NC_000913.3 GI:556503834
atggcgaaaaacctaatactctggctggtcattgccgttgtgctgatgtcagtattccag
agctttgggcccagcgagtctaatggccgtaaggtggattactctaccttcctacaagag
gtcaataacgaccaggttcgtgaagcgcgtatcaacggacgtgaaatcaacgttaccaag
aaagatagtaaccgttataccacttacattccggttcaggatccgaaattactggataac
ctgttgaccaagaacgtcaaggttgtcggtgaaccgcctgaagaaccaagcctgctggct
tctatcttcatctcctggttcccgatgctgttgctgattggtgtctggatcttcttcatg
cgtcaaatgcagggcggcggtggcaaaggtgccatgtcgtttggtaagagcaaagcgcgc
atgctgacggaagatcagatcaaaacgacctttgctgacgttgcgggctgcgacgaagca
aaagaagaagttgctgaactggttgagtatctgcgcgagccgagccgcttccagaaactc
ggcggtaagatcccgaaaggcgtcttgatggtcggtcctccgggtaccggtaaaacgctg
ctggcgaaagcgattgcaggcgaagcgaaagttccgttctttactatctccggttctgac
ttcgtagaaatgttcgtcggtgtgggtgcatcccgtgttcgtgacatgttcgaacaggcg
aagaaagcggcaccgtgcatcatctttatcgatgaaatcgacgccgtaggccgccagcgt
ggcgctggtctgggcggtggtcacgatgaacgtgaacagactctgaaccagatgctggtt
gagatggatggcttcgaaggtaacgaaggtatcatcgttatcgccgcgactaaccgtccg
gacgttctcgacccggccctgctgcgtcctggccgtttcgaccgtcaggttgtggtcggc
ttgccagatgttcgcggtcgtgagcagatcctgaaagttcacatgcgtcgcgtaccattg
gcacccgatatcgacgcggcaatcattgcccgtggtactcctggtttctccggtgctgac
ctggcgaacctggtgaacgaagcggcactgttcgctgctcgtggcaacaaacgcgttgtg
tcgatggttgagttcgagaaagcgaaagacaaaatcatgatgggtgcggaacgtcgctcc
atggtgatgacggaagcgcagaaagaatcgacggcttaccacgaagcgggtcatgcgatt
atcggtcgcctggtgccggaacacgatccggtgcacaaagtgacgattatcccacgcggt
cgtgcgctgggtgtgactttcttcttgcctgagggcgacgcaatcagcgccagccgtcag
aaactggaaagccagatttctacgctgtacggtggtcgtctggcagaagagatcatctac
gggccggaacatgtatctaccggtgcgtccaacgatattaaagttgcgaccaacctggca
cgtaacatggtgactcagtggggcttctctgagaaattgggtccactgctgtacgcggaa
gaagaaggtgaagtgttcctcggccgtagcgtagcgaaagcgaaacatatgtccgatgaa
actgcacgtatcatcgaccaggaagtgaaagcactgattgagcgtaactataatcgtgcg
cgtcagcttctgaccgacaatatggatattctgcatgcgatgaaagatgctctcatgaaa
tatgagactatcgacgcaccgcagattgatgacctgatggcacgtcgcgatgtacgtccg
ccagcgggctgggaagaaccaggcgcttctaacaattctggcgacaatggtagtccaaag
gctcctcgtccggttgatgaaccgcgtacgccgaacccgggtaacaccatgtcagagcag
ttaggcgacaagtaa
              
                            

Download fasta file
RegulonDB