RegulonDB RegulonDB 10.9: Gene Sequence
rlmE gene sequence


Size: 630        A: 151  T: 161  G: 181  C: 137

Fasta

 

>rlmE E. coli K12. Version NC_000913.3 GI:556503834
atgacaggtaagaagcgttctgccagctccagccgctggcttcaggaacactttagcgat
aaatatgttcaacaggcacagaaaaaggggttacgttcccgtgcctggtttaaacttgat
gaaatacagcaaagtgacaaactctttaaaccgggaatgacggttgtcgaccttggtgct
gctccgggtggttggtcacaatatgtggtcacccaaattggcggcaaaggccgcatcatc
gcttgcgatcttttacctatggatcctatcgttggtgtggactttcttcagggcgatttt
cgtgatgaactggtgatgaaagcactgctggagcgcgttggcgacagcaaagtccaggtt
gtcatgtccgatatggcaccaaacatgagcggaacaccggcggtggatatcccccgtgcc
atgtatctggtggaactggcgctagaaatgtgtcgtgatgtattagcgccaggtggcagt
tttgtagtgaaggtgttccagggcgaaggtttcgatgagtatctaagggaaattcgctcc
ctgtttacgaaggtcaaagttcgtaagccggactcttctcgtgcacgttcgcgggaagtg
tatattgtagcgaccgggcgtaaaccctaa
              
                            

Download fasta file
RegulonDB