RegulonDB RegulonDB 10.8: Gene Sequence
sra gene sequence


Size: 138        A: 52  T: 25  G: 27  C: 34

Fasta

 

>sra E. coli K12. Version NC_000913.3 GI:556503834
atgaaatcgaaccgtcaggcacgtcatattcttggactggaccataaaatttctaaccag
cgcaaaatagttaccgaaggtgacaaatccagcgtagtaaataacccaaccggcagaaaa
cgccccgctgaaaagtaa
              
                            

Download fasta file
RegulonDB