RegulonDB RegulonDB 10.9: Gene Sequence
glpX gene sequence


Size: 1011        A: 239  T: 198  G: 307  C: 267

Fasta

 

>glpX E. coli K12. Version NC_000913.3 GI:556503834
atgagacgagaacttgccatcgaattttcccgcgtcaccgaatcagcggcgctggctggc
tacaaatggttaggacgcggcgataaaaacaccgcggacggcgcggcggtaaacgccatg
cgtattatgctcaaccaggtcaacattgacggcaccatcgtcattggtgaaggtgaaatc
gacgaagcaccgatgctctacattggtgaaaaagtcggtactggtcgcggcgacgcggta
gatattgctgttgatccgattgaaggcacgcgcatgacggcgatgggccaggctaacgcg
ctggcggtgctggcagtaggcgataaaggctgcttcctcaatgcgccggatatgtatatg
gagaagctgattgtcgggccgggagccaaaggcaccattgatctgaacctgccgctggcg
gataacctgcgcaatgtagcggcggcgctcggcaaaccgttgagcgaactgacggtaacg
attctggctaaaccacgccacgatgccgttatcgctgaaatgcagcaactcggcgtacgc
gtatttgctattccggacggcgacgttgcggcctcaattctcacctgtatgccagacagc
gaagttgacgtgctgtacggtattggtggcgcgccggaaggcgtagtttctgcggcggtg
atccgcgcattagatggcgacatgaacggtcgtctgctggcgcgtcatgacgtcaaaggc
gacaacgaagagaatcgtcgcattggcgagcaggagctggcacgctgcaaagcgatgggc
atcgaagccggtaaagtattgcgcctgggcgatatggcgcgcagcgataacgtcatcttc
tctgccaccggtattaccaaaggcgatctgctggaaggcattagccgcaaaggcaatatc
gcgactaccgaaacgctgctgatccgcggcaagtcacgcaccattcgccgcattcagtcc
atccactatctggatcgcaaagacccggaaatgcaggtgcacatcctctga
              
                            

Download fasta file
RegulonDB