RegulonDB RegulonDB 10.8: Gene Sequence
fadD gene sequence


Size: 1686        A: 407  T: 416  G: 471  C: 392

Fasta

 

>fadD E. coli K12. Version NC_000913.3 GI:556503834
ttgaagaaggtttggcttaaccgttatcccgcggacgttccgacggagatcaaccctgac
cgttatcaatctctggtagatatgtttgagcagtcggtcgcgcgctacgccgatcaacct
gcgtttgtgaatatgggggaggtaatgaccttccgcaagctggaagaacgcagtcgcgcg
tttgccgcttatttgcaacaagggttggggctgaagaaaggcgatcgcgttgcgttgatg
atgcctaatttattgcaatatccggtggcgctgtttggcattttgcgtgccgggatgatc
gtcgtaaacgttaacccgttgtataccccgcgtgagcttgagcatcagcttaacgatagc
ggcgcatcggcgattgttatcgtgtctaactttgctcacacactggaaaaagtggttgat
aaaaccgccgttcagcacgtaattctgacccgtatgggcgatcagctatctacggcaaaa
ggcacggtagtcaatttcgttgttaaatacatcaagcgtttggtgccgaaataccatctg
ccagatgccatttcatttcgtagcgcactgcataacggctaccggatgcagtacgtcaaa
cccgaactggtgccggaagatttagcttttctgcaatacaccggcggcaccactggtgtg
gcgaaaggcgcgatgctgactcaccgcaatatgctggcgaacctggaacaggttaacgcg
acctatggtccgctgttgcatccgggcaaagagctggtggtgacggcgctgccgctgtat
cacatttttgccctgaccattaactgcctgctgtttatcgaactgggtgggcagaacctg
cttatcactaacccgcgcgatattccagggttggtaaaagagttagcgaaatatccgttt
accgctatcacgggcgttaacaccttgttcaatgcgttgctgaacaataaagagttccag
cagctggatttctccagtctgcatctttccgcaggcggtgggatgccagtgcagcaagtg
gtggcagagcgttgggtgaaactgaccggacagtatctgctggaaggctatggccttacc
gagtgtgcgccgctggtcagcgttaacccatatgatattgattatcatagtggtagcatc
ggtttgccggtgccgtcgacggaagccaaactggtggatgatgatgataatgaagtacca
ccaggtcaaccgggtgagctttgtgtcaaaggaccgcaggtgatgctgggttactggcag
cgtcccgatgctaccgatgaaatcatcaaaaatggctggttacacaccggcgacatcgcg
gtaatggatgaagaaggattcctgcgcattgtcgatcgtaaaaaagacatgattctggtt
tccggttttaacgtctatcccaacgagattgaagatgtcgtcatgcagcatcctggcgta
caggaagtcgcggctgttggcgtaccttccggctccagtggtgaagcggtgaaaatcttc
gtagtgaaaaaagatccatcgcttaccgaagagtcactggtgactttttgccgccgtcag
ctcacgggatacaaagtaccgaagctggtggagtttcgtgatgagttaccgaaatctaac
gtcggaaaaattttgcgacgagaattacgtgacgaagcgcgcggcaaagtggacaataaa
gcctga
              
                            

Download fasta file
RegulonDB