RegulonDB RegulonDB 10.9: Gene Sequence
yfiC gene sequence


Size: 738        A: 169  T: 182  G: 218  C: 169

Fasta

 

>yfiC E. coli K12. Version NC_000913.3 GI:556503834
atgtcacagtctacatccgtgcttcgtcgtaatggatttacttttaaacagttttttgtt
gctcacgatcgctgtgcgatgaaagtgggaacggatggtattttattgggcgcatgggca
ccggtggctggggtaaaacgttgccttgatatcggcgcgggtagcgggttgctggcatta
atgctggcgcagcgaaccgatgacagcgtgatgattgatgcagttgaactggaaagtgaa
gctgccgcgcaggcgcaggaaaatatcaaccagtccccgtgggcagagcggattaacgtc
catacggcggatattcagcagtggatcacacagcagacagtacgcttcgatttaatcatc
agtaacccaccttactatcagcagggagtagagtgctcgacacctcaacgggaacaggct
cgctataccactacgcttgatcacccatcgttgctgacctgtgcggcggagtgcattacc
gaagagggatttttctgcgtagtgctgccagagcagattggtaatggttttacggagctg
gcattaagcatgggctggcatttacgtttgcggacggatgtggcggaaaacgaagcgcga
ctgccgcatcgggtgctgctggcattctccccgcaggcgggagaatgctttagcgatcgc
ttagtcattcgtgggccagaccagaactattccgaagcgtatacggcgctgacccaggct
ttttatctgtttatgtaa
              
                            

Download fasta file
RegulonDB