RegulonDB RegulonDB 10.9: Gene Sequence
kup gene sequence


Size: 1869        A: 374  T: 534  G: 509  C: 452

Fasta

 

>kup E. coli K12. Version NC_000913.3 GI:556503834
atgagcactgataataagcaatcattgcccgcgattaccctcgcggcgattggagttgtc
tacggcgatattggtaccagcccgttatatacacttcgtgaatgtttgtccggccagttt
ggttttggcgttgaacgcgatgccgtgtttggctttttatcgctgatcttctggctgcta
atctttgtggtttccattaaatatctcaccttcgtgatgcgggcagataacgccggtgag
ggggggatcctgacgttgatgtcgcttgccgggcgtaatacgtcggcgcgaaccacatca
atgctggtgattatggggctaatcggcggcagctttttctatggtgaagtcgtcataaca
cccgctatttcggtgatgtcagccattgaaggtctggaaatcgtcgccccgcagctggat
acctggatagttcccctctcaattatcgttctcactttattatttatgattcaaaaacat
ggcacggctatggtcggtaagctgtttgcgccgatcatgctgacctggtttttgattctg
gcaggactggggttacgtagcattattgctaacccggaagtgctgcatgcgctgaatcca
atgtgggcggtgcatttcttccttgaatacaaaacggtttcttttattgcattaggggca
gtggtgttgtcgattacgggggtcgaggcgctgtatgctgatatggggcactttggtaag
ttccctattcgcctggcgtggttcaccgtcgtattaccttccttgacccttaattacttc
ggtcagggagcgctgttgttaaagaacccggaagcgattaagaacccgttcttcctgttg
gcaccggactgggcgctgatcccgctgctgatcatcgccgcactggcgacggtaattgcc
tcgcaggcggttatctctggcgtcttctcattgacgcgtcaggcggtacgtctgggatat
ttgtcgccgatgcgcattattcacacctccgaaatggagtcagggcaaatctatattccg
tttgtgaactggatgctctatgtcgcggtcgtgattgtgattgtcagctttgagcactcc
agcaacctggcggcggcgtacgggattgcggtgaccggaaccatggtgctgacgtctatt
ctctcgactaccgtggcacgtcagaactggcactggaataagtattttgttgcgctgatc
ctgattgctttcctttgtgtcgatattccattgttcaccgctaacctcgataaactgctc
tccggcggctggttgccattgagcctcggtactgtgatgtttatcgtgatgaccacctgg
aagagcgagcgtttccgcttgctgcggcggatgcatgaacatggtaactctctggaagcg
atgattgcttcgctggagaaatcaccgcctgttcgcgtgcccgggaccgcggtgtatatg
tcgcgtgcaatcaacgtcattccctttgcgctgatgcataaccttaaacataacaaggta
ttgcatgagcgggtgattctgttaactctgcgcaccgaagacgctccatatgtccataac
gtccgtcgggtacagattgaacaactgtcgcccactttctggcgcgtggtggcaagttat
ggttggcgagaaacgccaaacgtagaagaagttttccaccgctgcggtctggaaggatta
agttgccggatgatggaaacctccttctttatgtcgcatgagtcgttgatcctcggcaaa
cgcccgtggtatttgcgtctgcgcggcaagctgtacttgctgctgcaacgtaatgcgctg
cgtgcaccagatcaatttgaaatcccgccaaacagggttatcgaactgggtactcaggtc
gaaatctaa
              
                            

Download fasta file
RegulonDB