RegulonDB RegulonDB 10.10: Gene Sequence
glmM gene sequence


Size: 1338        A: 308  T: 302  G: 413  C: 315

Fasta

 

>glmM E. coli K12. Version NC_000913.3 GI:556503834
atgagtaatcgtaaatatttcggtaccgatgggattcgtggtcgtgtaggggatgcgccg
atcacacctgattttgtgcttaagctgggttgggccgcgggtaaagtgctggcgcgccac
ggctcccgtaagattattattggtaaagacacgcgtatttctggctatatgctggagtca
gcactggaagcgggtctggcggcagcgggcctttccgcactcttcactggcccgatgcca
acaccggccgtggcttatctgacgcgtaccttccgcgcagaggccggaattgtgatatct
gcatcgcataacccgttctacgataatggcattaaattcttctctatcgacggcaccaaa
ctgccggatgcggtagaagaggccatcgaagcggaaatggaaaaggagatcagctgcgtt
gattcggcagaactgggtaaagccagccgtatcgttgatgccgcgggtcgctatatcgag
ttttgcaaagccacgttcccgaacgaacttagcctcagtgaactgaagattgtggtggat
tgtgcaaacggtgcgacttatcacatcgcgccgaacgtgctgcgcgaactgggggcgaac
gttatcgctatcggttgtgagccaaacggtgtaaacatcaatgccgaagtgggggctacc
gacgttcgcgcgctccaggctcgtgtgctggctgaaaaagcggatctcggtattgccttc
gacggcgatggcgatcgcgtgattatggttgaccatgaaggcaataaagtcgatggcgat
cagatcatgtatatcatcgcgcgtgaaggtcttcgtcagggccagctgcgtggtggcgct
gtgggtacattgatgagcaacatggggcttgaactggcgctgaaacagttaggaattcca
tttgcgcgcgcgaaagtgggtgaccgctacgtactggaaaaaatgcaggagaaaggctgg
cgtatcggtgcagagaattccggtcatgtgatcctgctggataaaactactaccggtgac
ggcatcgttgctggcttgcaggtgctggcggcgatggcacgtaaccatatgagcctgcac
gacctttgcagcggcatgaaaatgttcccgcagattctggttaacgtacgttacaccgca
ggtagcggcgatccacttgagcatgagtcagttaaagccgtgaccgcagaggttgaagct
gcgctgggcaaccgtggacgcgtgttgctgcgtaaatccggcaccgaaccgttaattcgc
gtgatggtggaaggcgaagacgaagcgcaggtgactgaatttgcacaccgcatcgccgat
gcagtaaaagccgtttaa
              
                            

Download fasta file
RegulonDB