RegulonDB RegulonDB 10.8: Gene Sequence
stpA gene sequence


Size: 405        A: 126  T: 84  G: 102  C: 93

Fasta

 

>stpA E. coli K12. Version NC_000913.3 GI:556503834
atgtccgtaatgttacaaagtttaaataacattcgcaccctccgtgcgatggctcgcgaa
ttctccattgacgttcttgaagaaatgctcgaaaaattcagggttgtcactaaagaaaga
cgtgaagaagaagaacagcagcagcgtgaactggcagagcgccaggaaaaaattagcacc
tggctggagctgatgaaagctgacggaattaacccggaagagttattgggtaatagctct
gctgctgcaccacgcgctggtaaaaaacgccagccgcgtccggcgaaatataaattcacc
gatgttaacggtgaaactaaaacctggaccggtcagggccgtacaccgaagccaattgct
caggcgctggcagaaggtaaatctctcgacgatttcctgatctaa
              
                            

Download fasta file
RegulonDB