RegulonDB RegulonDB 10.6.3: Gene Sequence
caiC gene sequence


Size: 1554        A: 383  T: 378  G: 419  C: 374

Fasta

 

>caiC E. coli K12. Version NC_000913.3 GI:556503834
atggatatcattggcggacaacatctacgtcaaatgtgggacgatcttgcggacgtttac
ggtcataaaacggcgctgatttgtgaatccagcggcggagtcgttaaccggtatagttat
cttgagttaaatcaggagattaaccgcacggcaaacctgttttatacgctggggattcgc
aaaggcgacaaggttgcactacatctcgacaactgcccggaatttatcttttgctggttc
gggctggcaaaaattggcgcgattatggtgccgattaacgcccgcctgttgtgcgaggaa
agcgcgtggatcctgcaaaatagccaggcgtgcctgctggtgaccagtgcgcaattctat
cctatgtatcaacagattcagcaggaagatgccactcaattgcggcacatttgcctgaca
gatgtggcacttcccgctgatgatggcgtgagttcgtttactcaactgaaaaatcaacaa
cctgccaccttgtgctatgcaccgccgctatcgactgacgatacggcggaaattctcttc
acctccggcaccacctcccgaccgaaaggtgtggtgattacccattacaacctgcgcttc
gctggatattactccgcctggcagtgtgcactgcgtgacgatgacgtctacctgacggta
atgcctgcgtttcatatcgattgccagtgtactgcggcgatggcggcgttttctgccggg
gccacctttgtgctggtcgagaaatacagcgcccgcgccttctggggacaggtacagaag
taccgcgccaccgttaccgaatgtattccgatgatgatccgtacgttgatggtacagccg
ccttcagcgaacgatcagcaacaccgcctgcgggaagtgatgttttatctcaacttgtcg
gagcaggaaaaagatgcgttttgtgaacgcttcggcgttcgcttgctgacgtcttatggg
atgacggaaaccattgtgggcattatcggcgatcgtcctggcgataaacgacgctggccg
tcgattggtcgggtggggttttgctacgaagcggagatccgcgacgatcacaatcgcccg
ctcccggctggtgagatcggtgaaatctgcattaaaggcatacctgggaaaaccatcttc
aaagagtactttctcaacccacaagccactgcgaaagtgctggaagccgatggctggctg
cataccggcgataccggataccgcgacgaagaggactttttttatttcgtcgatcgccgc
tgcaatatgattaaacgtggcggcgagaatgtctcctgcgtggagctggaaaatattatc
gccgcgcacccgaaaattcaggacatcgtggttgtgggtattaaagattcgattcgcgat
gaagccatcaaagcatttgtggtgctgaatgaaggtgaaacattgagcgaagaggaattt
ttccgcttctgcgaacaaaatatggcgaaatttaaagtgccctcttatctggagatcaga
aaagatctgccacgtaattgctcggggaaaataattagaaagaatctgaaataa
              
                            

Download fasta file
RegulonDB