RegulonDB RegulonDB 10.8: Gene Sequence
caiB gene sequence


Size: 1218        A: 313  T: 264  G: 314  C: 327

Fasta

 

>caiB E. coli K12. Version NC_000913.3 GI:556503834
atggatcatctacccatgccgaaattcgggccgttggccggattgcgcgttgtcttctcc
ggtatcgaaatcgccggaccgtttgccgggcaaatgttcgcagaatggggcgcggaagtt
atctggatcgagaacgtcgcctgggccgacaccattcgcgttcaaccgaactacccgcaa
ctctcccgccgcaatttgcacgcgctgtcgttaaatattttcaaagatgaaggccgcgaa
gcgtttctgaaattaatggaaaccaccgatatcttcatcgaagccagtaaaggtccggcc
tttgcccgtcgtggcattaccgatgaagtactgtggcagcacaacccgaaactggttatc
gctcacctgtccggttttggtcagtacggcaccgaggagtacaccaatcttccggcctat
aacactatcgcccaggcctttagtggttacctgattcagaacggtgatgttgaccagcca
atgcctgccttcccgtataccgccgattacttttctggcctgaccgccaccacggcggcg
ctggcagcactgcataaagtgcgtgaaaccggtaaaggcgaaagtatcgacatcgccatg
tatgaagtgatgctgcgtatgggccagtacttcatgatggattacttcaacggcggcgaa
atgtgcccgcgcatgagcaaaggtaaagatccctactacgccggttgcggtctgtataaa
tgtgccgacggctacatcgtgatggaactggtgggcattacccaaattgaagagtgcttt
aaagatattggcctcgcacatctgcttggcacgccagaaatcccggaaggcactcagctt
atccaccgtatcgaatgcccttacggcccactggttgaagagaaactcgatgcctggctg
gcgacacataccatcgcggaagtaaaagaacgctttgctgaactgaatatcgcctgcgcc
aaagtgctgaccgtaccggaactggaaagcaatccacagtatgtggctcgcgaatcaatc
actcagtggcaaacgatggatggtcgcacctgcaaagggccgaacatcatgccgaaattc
aaaaataaccccggacaaatctggcgcggaatgccctcacatggcatggacacggctgcc
attttgaaaaatatcggctacagcgaaaacgacattcaggagttggtcagcaaaggtctg
gccaaagttgaggactaa
              
                            

Download fasta file
RegulonDB