RegulonDB RegulonDB 10.8: Gene Sequence
caiA gene sequence


Size: 1143        A: 273  T: 254  G: 339  C: 277

Fasta

 

>caiA E. coli K12. Version NC_000913.3 GI:556503834
atggattttaatttaaatgatgagcaggaactgtttgtcgccggtatccgcgaactgatg
gccagcgaaaactgggaggcctattttgccgagtgcgaccgtgacagcgtctacccggaa
cgttttgtcaaagcactggcggatatgggtatcgacagtctgctgatccctgaagagcac
ggtggtctggacgcggggtttgttactctcgccgccgtgtggatggagctgggacgtctg
ggggcaccaacctatgtgctgtaccagttgccgggcgggttcaacaccttcctgcgcgaa
ggcacacaagagcagatcgacaaaattatggctttccgcggcaccggtaagcagatgtgg
aactcagcgattaccgaaccgggcgcgggctccgacgtgggtagcctgaaaacgacttat
acccgtagaaatggtaagatttatcttaatggtagtaagtgttttattaccagcagcgcc
tacaccccgtacatcgtggtgatggcgcgcgacggggcttctccggacaaacctgtctac
accgaatggtttgttgatatgagcaaaccgggcatcaaagtgaccaaacttgaaaagctc
ggtctgcgtatggatagctgctgtgaaatcacctttgacgacgtggaactggacgagaaa
gacatgttcggtcgggaaggtaacggctttaaccgcgtcaaagaagagttcgaccatgaa
cgtttcctggtagccctcaccaactacggtacggcgatgtgcgcctttgaagatgcggcg
cgctacgccaatcagcgcgtgcagtttggcgaggctattggtcgtttccagttgattcag
gaaaaattcgcccacatggcgatcaaattaaactccatgaaaaacatgctgtatgaagca
gcgtggaaagcagacaacggcaccatcacctctggcgatgcagcgatgtgcaaatacttc
tgcgccaatgcggcatttgaagttgtggatagcgcaatgcaggtgctgggcggtgtcggg
attgcgggcaaccaccgcatcagccgcttctggcgtgatctgcgtgtagaccgcgtctcc
gggggatctgacgaaatgcagatcctgacgctgggtcgtgcggtgctgaagcaataccgc
taa
              
                            

Download fasta file
RegulonDB