RegulonDB RegulonDB 10.8: Gene Sequence
caiT gene sequence


Size: 1515        A: 306  T: 424  G: 400  C: 385

Fasta

 

>caiT E. coli K12. Version NC_000913.3 GI:556503834
atgaagaatgaaaagagaaaaacgggaatagaaccgaaggttttctttccgccgttaata
atcgtcggcatactttgttggcttacagtcagagatctggatgcagcgaatgtcgttatt
aatgctgtattcagttacgtcaccaatgtatggggatgggcatttgaatggtatatggtg
gtgatgcttttcggttggttctggctggtgtttggcccgtatgccaaaaagcgtttaggt
aacgaaccgccagaatttagcaccgccagttggatctttatgatgttcgcctcctgtacg
tctgctgccgtactgttctggggatcgattgagatctactactacatctccaccccgccg
tttggcttagaaccgaactcgacaggggcgaaagagttggggctggcttacagcttgttc
cactggggacctctgccgtgggccacttacagcttcctttcagtcgccttcgcttacttc
ttctttgtccgcaaaatggaagtgattcgccccagctcgacactggtgccgctggtaggt
gaaaaacacgccaaagggttgttcggcactatcgtcgacaacttctatctcgtcgccttg
atcttcgcgatgggtaccagtctgggccttgccacgccgctggtgaccgagtgtatgcaa
tggttgtttggcattccgcataccctgcaactggacgctatcatcattacctgctggatt
atcctcaacgccatttgcgtcgcttgcggtctgcaaaaaggggtacgtatcgccagtgac
gtgcgtagttacctgagcttcctgatgctgggttgggtgttcattgtcagcggtgccagc
ttcatcatgaactacttcaccgattcggtggggatgttgctgatgtatctgccgcgcatg
ttgttctataccgatcccatcgctaaaggcggcttcccgcagggctggaccgtgttctac
tgggcatggtgggtgatttatgctatccagatgagtatcttcctcgcccgcatctcccgt
ggtcgtactgtgcgtgaactgtgcttcggcatggtgctggggctgacagcgtcaacctgg
atcctgtggactgtactcggtagtaacactctgctgttgatagataaaaacatcatcaac
attccaaatctgatcgaacagtacggtgtggcgcgcgccatcattgaaacctgggccgct
ctgccactcagcaccgccaccatgtggggcttcttcatcctctgctttattgccaccgtt
acgctggttaacgcctgctcttataccctggcgatgtccacttgccgcgaagtacgcgat
ggtgaagaaccacctctgctggtgcgtatcggttggtcaattctggttggcattatcggt
attgttctgctggcgctcggcggcctgaaaccgattcaaaccgccattatcgccggagga
tgcccgctgttcttcgtcaacattatggtgacgctctcctttattaaagacgcgaaacag
aactggaaagattaa
              
                            

Download fasta file
RegulonDB