RegulonDB RegulonDB 10.8: Gene Sequence
fixA gene sequence


Size: 771        A: 201  T: 165  G: 209  C: 196

Fasta

 

>fixA E. coli K12. Version NC_000913.3 GI:556503834
atgaagattattacttgctataagtgcgtgcctgatgaacaggatattgcggtcaataat
gctgatggttcattagacttcagcaaagccgatgccaaaataagccaatacgatctcaac
gctattgaagcggcttgccagctaaagcaacaggcagcagaggcgcaggtgacagcctta
agtgtgggcggtaaagccctgaccaacgccaaagggcgtaaagatgtgctatcgcgcggc
ccggatgaactgattgtggtgattgatgaccagttcgagcaggcactgccgcaacaaacg
gcgagcgcactggctgcagccgcccagaaagcaggctttgatctgatcctctgtggcgat
ggttcttccgacctttatgcccagcaggttggtctgctggtgggcgaaatcctcaatatt
ccggcagttaacggcgtcagcaaaattatctccctgacggcagataccctcaccgttgag
cgcgaactggaagatgaaaccgaaaccttaagcattccgctgcctgcggttgttgctgtt
tccactgatatcaactccccacaaattccttcgatgaaagccattctcggcgcggcgaaa
aagcccgtccaggtatggtcggcggcggatattggttttaacgcagaggcagcctggtca
gaacaacaggttgccgcgccgaaacagcgcgaacgtcagcgcatcgtgattgaaggcgac
ggcgaagaacagatcgccgcatttgctgaaaatcttcgcaaagtcatttaa
              
                            

Download fasta file
RegulonDB