RegulonDB RegulonDB 10.8: Gene Sequence
fixB gene sequence


Size: 942        A: 223  T: 185  G: 275  C: 259

Fasta

 

>fixB E. coli K12. Version NC_000913.3 GI:556503834
atgaacacgttttctcaagtctgggtattcagcgataccccttctcgtctgccggaactg
atgaacggtgcgcaggctttagctaatcaaatcaacacctttgtcctcaatgatgccgac
ggcgcacaggcaatccagctcggcgctaatcatgtctggaaattaaacggcaaaccggac
gatcggatgatcgaagattacgccggtgtcatggctgacactattcgccagcacggcgca
gacggcctggtgctgctgccaaacacccgtcgcggcaaattactggcggcaaaactgggt
tatcgccttaaagcggcggtgtctaacgatgccagcaccgtcagcgtacaggacggtaaa
gcgacagtgaaacacatggtttacggtggtctggcgattggcgaagaacgcattgccacg
ccgtatgcggtactgaccatcagcagcggcacgttcgatgcggctcagccagacgcgtca
cgcactggcgaaacgcacaccgtggagtggcaggctccggctgtggcgattacccgcacg
gcaacccaggcgcgccagagcaacagcgtcgatctcgacaaagcccgtctggtggtcagc
gtcggtcgcggtattggcagcaaagagaacattgcgctggcagaacagctttgcaaggcg
ataggtgcggagttggcctgttctcgtccggtggcggaaaacgaaaaatggatggagcac
gaacgctatgtcggtatctccaacctgatgctgaaacctgaactgtacctggcggtgggg
atctccgggcagatccagcacatggttggcgctaacgcgtcgcaaaccattttcgccatc
aataaagataaaaatgcgccgatcttccagtacgcggattacggcattgttggcgacgcc
gtgaagatccttccggcgctgaccgcagctttagcgcgttga
              
                            

Download fasta file
RegulonDB