RegulonDB RegulonDB 10.8: Gene Sequence
fixC gene sequence


Size: 1287        A: 292  T: 288  G: 388  C: 319

Fasta

 

>fixC E. coli K12. Version NC_000913.3 GI:556503834
atgtccgaagatatctttgacgccatcatcgtcggtgcagggcttgccggttcggttgcc
gcactggtgctcgcccgcgaaggtgcgcaagtgttagttatcgagcgtggcaattccgca
ggtgccaagaacgtcaccggcgggcgtctctatgcccacagtctggaacacattattcct
ggtttcgccgactccgcccccgtagaacgcctgatcacccatgaaaaactcgcgtttatg
acggaaaagtcagcgatgactatggactactgcaatggtgacgaaacctcgccatcccag
cgttcttactccgttttgcgcagtaaatttgatgcctggctgatggagcaggccgaagaa
gcgggcgcgcagttaattaccgggatccgcgtcgataacctcgtacagcgcgatggcaaa
gtcgtcggtgtagaagccgatggcgatgtgattgaagcgaaaacggtgatccttgctgat
ggggtgaactccatccttgccgaaaaattggggatggcaaaacgcgtcaaaccgacggat
gtggcggttggcgtgaaggaactgatcgagttaccgaagtcggttattgaagaccgtttt
cagttgcagggtaatcagggggcggcttgcctgtttgcgggatcacccaccgatggcctg
atgggcggcggcttcctttataccaatgaaaacaccctgtcgctggggctggtttgtggt
ttgcatcatctgcatgacgcgaaaaaatcggtgccgcaaatgctggaagatttcaaacag
catccggccgttgcaccgctgatcgcgggcggcaagctggtggaatattccgctcacgta
gtgccggaagcaggcatcaacatgctgccggagttggttggtgacggcgtattgattgcc
ggtgatgccgccggaatgtgtatgaacctcggttttaccattcgcggtatggatctggcg
attgccgccggggaagccgcagcaaaaaccgtgctttcagcgatgaaaagcgacgatttc
agtaagcaaaaactggcggaatatcgtcagcatcttgagagtggtccgctgcgcgatatg
cgtatgtaccagaaactaccggcgttccttgataacccacgcatgtttagcggctacccg
gagctggcggtgggtgtggcgcgtgacctgttcaccattgatggcagcgcgccggaactg
atgcgcaagaaaatcctccgccacggcaagaaagtgggcttcatcaatctaatcaaggat
ggcatgaaaggagtgaccgttttatga
              
                            

Download fasta file
RegulonDB