RegulonDB RegulonDB 10.8: Gene Sequence
fixX gene sequence


Size: 288        A: 60  T: 64  G: 96  C: 68

Fasta

 

>fixX E. coli K12. Version NC_000913.3 GI:556503834
atgacttctcccgtcaatgtggacgtcaaactgggcgtcaataaattcaatgtcgatgaa
gagcatccgcacattgttgtgaaggccgatgctgataaacaggcgctggagctgctggtg
aaagcgtgccccgcaggtctgtacaagaagcaggatgacggcagtgtgcgcttcgattac
gccggatgtctggagtgcggcacctgtcgcattctggggctggggtcggcgctggaacag
tgggaatacccgcgcggcacctttggtgtggagttccgttacggctga
              
                            

Download fasta file
RegulonDB