RegulonDB RegulonDB 10.8: Gene Sequence
lptD gene sequence


Size: 2355        A: 604  T: 541  G: 595  C: 615

Fasta

 

>lptD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaacgtatccccactctcctggccaccatgattgccaccgccctttatagtcaa
cagggactggcagccgacctcgcctcacagtgcatgttgggcgtgccaagctatgaccgt
cctctggtacagggcgataccaatgacttacccgtgactatcaatgctgaccacgcgaaa
ggggactacccggatgacgccgtgtttactggcagcgtggatatcatgcagggtaacagc
cgtctgcaggccgacgaagtgcagctccatcaaaaagaggcaccaggacaaccggagccg
gtacgtaccgttgatgcgctcggtaatgtccattacgacgataaccaggtgatcctcaaa
gggccgaaaggctgggcgaatctgaacaccaaagataccaacgtctgggaaggtgattac
cagatggtgggtcgccagggtcgcggtaaagcggacctgatgaaacaacgtggcgaaaac
cgctataccattctggataacggtagctttacctcctgtctgccgggttctgacacctgg
agcgtggtaggtagcgaaattattcatgaccgcgaagaacaagttgcggagatctggaac
gcccgctttaaggtgggtccggtaccgatcttttatagcccctatttgcagttgccggtg
ggtgacaaacgtcgctctggtttcttgatcccgaacgccaagtacaccaccaccaactac
tttgagttctacctgccatattactggaacatcgcgccaaatatggatgccaccatcacg
ccgcattatatgcatcgtcgtggcaacatcatgtgggagaacgaattccgctacctctcc
caggcgggcgctggcttgatggaactggactatctgccttcagataaagtctatgaagat
gaacacccgaacgatgacagttcacgtcgttggttattctactggaaccactccggggtc
atggatcaggtgtggcgtttcaacgtcgactacaccaaggtcagcgatcctagctacttc
aatgatttcgataacaagtacggttccagtactgacggctacgcaacgcaaaaattcagc
gttggctatgcggtgcaaaacttcaatgccaccgtttcaaccaagcagttccaggttttc
agcgaacagaacaccagtagctactcggcagagccgcagttagacgttaattactaccag
aatgatgttggtccgtttgatacgcgtatttacggccaggcagtgcactttgttaacacc
agagacgacatgcctgaagcaacccgtgttcacctggaaccgaccatcaatttgccgctc
tctaataactggggcagcatcaataccgaagcgaagttgctggcaacccattatcagcaa
accaatcttgactggtataactccagaaacacgaccaagctggacgaatccgttaaccgc
gtaatgccgcaattcaaagttgacggcaaaatggtctttgaacgcgatatggaaatgctg
gctccgggttatacccaaacgctggaaccgcgcgcgcagtatttgtacgtgccgtatcgc
gatcagagcgacatctataactacgactcgtctctgctgcaatctgactactctggcctg
ttccgggaccggacttacggcggtcttgaccgtattgcctccgctaaccaggtgacgacc
ggtgtcacatctcgcatatatgatgatgctgccgttgaacgttttaatatttccgttggt
caaatctactatttcacggagtctcgcactggcgatgacaacataacatgggagaatgac
gacaaaacgggttcactggtgtgggcaggcgatacttactggcgtatctccgagcgttgg
ggattgcgtggcgggattcagtacgatacacgtctggataacgtagcgaccagtaactcc
agcattgaataccgtcgggatgaagaccgtctggtacagctgaattaccgttacgccagc
ccggaatatattcaggctacgctgcctaagtactattccactgctgagcaatataagaat
ggtatttcgcaggtaggtgctgtcgccagctggccaattgccgatcgttggtccattgtt
ggggcctactactacgacaccaatgctaacaagcaagccgactctatgttaggtgtgcaa
tacagctcctgctgctatgcaattcgcgtcggttacgagcggaagctgaacggttgggat
aacgataaacaacatgcggtatatgacaacgcaatcggctttaacatcgaacttcgcggc
ctgagctccaactacggtctgggtacgcaagagatgctgcgttcgaacattctgccgtat
caaaacactttgtga
              
                            

Download fasta file
RegulonDB