RegulonDB RegulonDB 10.10: Gene Sequence
leuB gene sequence


Size: 1092        A: 253  T: 233  G: 308  C: 298

Fasta

 

>leuB E. coli K12. Version NC_000913.3 GI:556503834
atgtcgaagaattaccatattgccgtattgccgggggacggtattggtccggaagtgatg
acccaggcgctgaaagtgctggatgccgtgcgcaaccgctttgcgatgcgcatcaccacc
agccattacgatgtaggcggcgcagccattgataaccacgggcaaccactgccgcctgcg
acggttgaaggttgtgagcaagccgatgccgtgctgtttggctcggtaggcggcccgaag
tgggaacatttaccaccagaccagcaaccagaacgcggcgcgctgctgcctctgcgtaag
cacttcaaattattcagcaacctgcgcccggcaaaactgtatcaggggctggaagcattc
tgtccgctgcgtgcagacattgccgcaaacggcttcgacatcctgtgtgtgcgcgaactg
accggcggcatctatttcggtcagccaaaaggccgcgaaggtagcggacaatatgaaaaa
gcctttgataccgaggtgtatcaccgttttgagatcgaacgtatcgcccgcatcgcgttt
gaatctgctcgcaagcgtcgccacaaagtgacgtcgatcgataaagccaacgtgctgcaa
tcctctattttatggcgggagatcgttaacgagatcgccacggaatacccggatgtcgaa
ctggcgcatatgtacatcgacaacgccaccatgcagctgattaaagatccatcacagttt
gacgttctgctgtgctccaacctgtttggcgacattctgtctgacgagtgcgcaatgatc
actggctcgatggggatgttgccttccgccagcctgaacgagcaaggttttggactgtat
gaaccggcgggcggctcggcaccagatatcgcaggcaaaaacatcgccaacccgattgca
caaatcctttcgctggcactgctgctgcgttacagcctggatgccgatgatgcggcttgc
gccattgaacgcgccattaaccgcgcattagaagaaggcattcgcaccggggatttagcc
cgtggcgctgccgccgttagtaccgatgaaatgggcgatatcattgcccgctatgtagca
gaaggggtgtaa
              
                            

Download fasta file
RegulonDB