RegulonDB RegulonDB 10.8: Gene Sequence
marB gene sequence


Size: 219        A: 50  T: 59  G: 50  C: 60

Fasta

 

>marB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaccactttcatccgcaatagcagctgcgcttattctcttttccgcgcagggcgtt
gcggaacaaaccacgcagccagttgttacttcttgtgccaatgtcgtggttgttccccca
tcgcaggaacacccaccgtttgatttaaatcacatgggtactggcagtgataagtcggat
gcgctcggcgtgccctattataatcaacacgctatgtag
              
                            

Download fasta file
RegulonDB